We narrowed to 6,165 results for: cas9 expression plasmid
-
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP
Plasmid#50716Purpose5’ and 3’ EGFP fragments that shares 482bp were placed under ubiquitous CAG promoter. Used for validation of gRNA sequences by DSB mediated EGFP reconstitution.DepositorInsertsplit EGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
UseTagsVPRExpressionMammalianMutationPromoterCMVAvailable sinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…TagsExpressionMutationPromoterAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP469
Plasmid#65771PurposeHuman expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP680
Plasmid#65772PurposeHuman expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat
Plasmid#232097PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with NatMX selectionDepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan
Plasmid#232099PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with KanMX selectionDepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidTagsExpressionMammalianMutationPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)PromoterAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCASB
Plasmid#190175PurposePlasmid for yeast expression of Cas9; contains a golden gate cloning site to additionally express a gRNA for a target sequenceDepositorInsertsgRNA cloning site
UseTagsExpressionBacterial and YeastMutationAdded 5'-agagacc-3' upstream and 5'…PromoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only