173,150 results

#108529

TetR + PTet*-YFP Reporter. aTc sensor for use in non-Marionette strain.

Christopher Voigt

Meyer et al Nat Chem Biol. 2018 Nov 26. pii: 10.1038

June 29, 2018

Academic Institutions and Nonprofits only

#157686

mammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp5 under control of a tetracycline-inducible promoter

David Tollervey

Bresson et al Wellcome Open Res. 2020 Nov 3;5:261. doi

Aug. 5, 2020

Industry, Academic Institutions, and Nonprofits

#156452

Targeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG

Elphege Nora

Liu et al Nat Genet. 2021 Jan;53(1):100-109. doi:

Sept. 2, 2020

Academic Institutions and Nonprofits only

#136815

Mammalian expression of the centrosomal protein CENPJ N-terminally fused to SNAP-tag

Kai Johnsson

Lukinavicius et al Curr Biol. 2013 Feb 4;23(3):265-70. doi:

March 26, 2020

Academic Institutions and Nonprofits only

#231111

C>T base editor

John Doench, David Root

Kaplan et al Nat Genet. 2025 Nov;57(11):2920-2929. do

Jan. 21, 2025

Academic Institutions and Nonprofits only

#218738

Expresses C-terminally EGFP-tagged IFT139 in mammalian cells

Kazuhisa Nakayama

May 22, 2024

Academic Institutions and Nonprofits only

#192065

Expression of mCherry, sesRNA in mammalian cells, with GFP as efRNA.

Josh Huang

Qian et al Nature. 2022 Oct;610(7933):713-721. doi:

Feb. 3, 2023

Academic Institutions and Nonprofits only

#12965

Gary Bokoch

Subauste et al J Biol Chem. 2000 Mar 31. 275(13):9725-3

Oct. 27, 2006

Academic Institutions and Nonprofits only

#68463

Cas9 sgRNA vector for cloning

Su-Chun Zhang

Chen et al Cell Stem Cell. 2015 Jul 1. pii: S1934-5

Nov. 25, 2015

Academic Institutions and Nonprofits only