We narrowed to 5,965 results for: crispr cas9 expression plasmids
-
Plasmid#72250PurposeHuman expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, R1335Q, and T…PromoterCMVAvailable sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
UseTagsExpressionBacterialMutationPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG (Lenti_sgRNA_EFS_GFP)
Plasmid#65656PurposeLentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter-driven sgRNA expression and EFS promo…Available sinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTF1.1.0-gDNA
Plasmid#113797PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MTF1DepositorInsertMTF1 (MTF1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorInsertZBTB9 (ZBTB9 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorInsertZBTB5 (ZBTB5 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF436.1.0-gDNA
Plasmid#113767PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF436DepositorInsertZNF436 (ZNF436 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorInsertZFX (ZFX Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXD1.1.0-gDNA
Plasmid#112446PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MXD1DepositorInsertMXD1 (MXD1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUSF2.1.0-gDNA
Plasmid#112457PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor USF2DepositorInsertUSF2 (USF2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF331.1.0-gDNA
Plasmid#112461PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF331DepositorInsertZNF331 (ZNF331 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVEZF1.1.0-gDNA
Plasmid#112437PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor VEZF1DepositorInsertVEZF1 (VEZF1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF416.1.0-gDNA
Plasmid#112468PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF416DepositorInsertZNF416 (ZNF416 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNFXL1.1.0-gDNA
Plasmid#112451PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NFXL1DepositorInsertNFXL1 (NFXL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOVOL1.1.0-gDNA
Plasmid#113794PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor OVOL1DepositorInsertOVOL1 (OVOL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only