We narrowed to 7,952 results for: Lif
-
Plasmid#207077PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD3 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD1 HRD
Plasmid#207076PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD1 locus.DepositorInsertHaloTag flanked by human SHLD1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLX304-HsTtyh1-TwinStrep-His
Plasmid#211332PurposeMammalian overexpression vector for C-terminally TwinStrep and His tagged human Ttyh1 (W417R)DepositorInsertTweety homology protein 1
UseLentiviralTagsTwinStrep, 10xHisExpressionMammalianMutationW417RPromoterCMVAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rif1-Halo HRD
Plasmid#207081PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nef-AO-66-71-TVA950
Plasmid#217977PurposeAAV Transfer plasmid to express TVA950 in a Cre-dependent mannerDepositorInsertTVA950
UseAAVPromoternEFAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1318
Plasmid#217960PurposeExpression of human H4 carrying three point mutations to disrupt binding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
TagseGFPExpressionMammalianMutationL63A, F66A, I71APromoterCMVAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1317
Plasmid#217959PurposeExpression of human H4 carrying a triple glycine insertion to disrupt folding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
TagseGFPExpressionMammalianMutationGGG insertion between V65 and F66PromoterCMVAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-COX1-4
Plasmid#184722PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-COX2-4
Plasmid#184723PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PTGER2
Plasmid#184724PurposeEP2-KO in MDCKDepositorInsertA gRNA targeting the dog EP2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PLA2G4A_3
Plasmid#184725PurposecPLA2-KO in MDCKDepositorInsertA gRNA targeting the dog cPLA2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-PTGER4
Plasmid#184726PurposeEP4-KO in MDCKDepositorInsertA gRNA targeting the dog EP4 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MsACR1-pmCerulean3-N1
Plasmid#204958PurposeExpression of channelrhodopsin MsACR1 fused to mCerulean3 in mammalian cellsDepositorInsertMsACR1
TagsmCerulean3ExpressionMammalianPromoterCMV (+enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-dnHIF
Plasmid#206343PurposeAAV plasmid expressing dominant negative HIF1A in photoreceptorsDepositorInsertdominant negative hif1a
UseAAVMutationdominant negative HIF1APromoter1.7kb human red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shNC
Plasmid#206356PurposeAAV plasmid expressing non-targeting control shRNA in photoreceptorsDepositorInsertNon-targeting control shRNA
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 AMSHLP 16-218
Plasmid#180609PurposeBacterial expression for AMSHLP MIT domain residues 16-218. Internal ID: WISP20-83DepositorInsertAMSHLP residues 16-218
TagsHIS-SUMOExpressionBacterialMutationResidues 16-218PromoterT7Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only