We narrowed to 1,003 results for: dTomato
-
Plasmid#200252PurposepBac-U6-gRNA(doublesex)-3xp3-tdTomatoDepositorInsert4 gRNAs targeting Doublesex
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
OA-1055J
Plasmid#200251PurposepBac-U6-gRNA(Intersex)-3xp3-tdTomatoDepositorInsert2 gRNAs targeting Intersex gene
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJDC122
Plasmid#157876PurposetdTomato is expressed under the mycobacterial phsp60 heat shock promoter for in vivo and in vitro detection.DepositorInserttdTomato
ExpressionBacterialAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
RV-Cag-Dio-mTdt
Plasmid#87665Purposeretroviral vector encoding cre dependent expression of membrane TdtomatoDepositorInsertMem-Tdtomato
UseRetroviralPromoterCAGAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pO5
Plasmid#193749PurposeExpresses tdTomato under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selectionDepositorInserttdTomato
ExpressionBacterialPromoterPIAHAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCITF-KCC2
Plasmid#61404PurposeMammalian expression vector for human KCC2 under CAG promoter. Coexpression of TdTomato with IRES sequenceDepositorAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
INS-2A-luciferase-2A-tdT
Plasmid#159348PurposeHuman INS targeting vector for knockin of 2A separated luciferase and tdTomato. Targeted cells will be puromycin resistant.DepositorInsertLuciferase-2A-tdTomato
UseIns locus knockin donor vectorAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBDR
Plasmid#62663PurposeDonor vector for tdTomato knock-in via landing padDepositorInserttdTomato
UseCre/LoxAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only