We narrowed to 4,780 results for: INV-E
-
Plasmid#8890DepositorInsertFatty Acid Synthetase Promoter (Fasn unknown - rat or mouse, Rat)
UseLuciferaseTagsluciferaseExpressionMammalianAvailable SinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
GST-Delta23C11orf83
Plasmid#65849Purposebacterial expression of GST (N-ter) - Delta 23 C11orf83/UQCC3 (UQCC3 protein depleted of its N-terminal transmembrane domain)DepositorInsertUQCC3 depleted of its N terminal transmembrane part (UQCC3 Human)
TagsGSTExpressionBacterialMutationdeletion of the 23 first aa (TM)Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mCerulean3-P2A-mKOFP2-CAAX
Plasmid#75154PurposeNuclear mCerulean2 (blue) fluorophore and a membrane targeted KOFP2 (orange) fluorophore separated by a self-cleaving 2A peptide for use with 5’ promoters.DepositorInsertH2B-mCerulean3-P2A-mKOFP2-CAAX
UseMiddle entry vector for multisite gateway three f…Promotern/aAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-CENPB-N-22
Plasmid#58081PurposeLocalization: Nucleus/Centromeres, Excitation: 554, Emission: 581DepositorInsertCENPB (CENPB Human)
TagstdTomatoExpressionMammalianMutationaa 1-169 of CENPB (DNA Binding Domain)PromoterCMVAvailable SinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_CD19.4
Plasmid#140101PurposeCRISPR-Cas9 Knock downDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralAvailable SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- WTN23C11orf83-GFP
Plasmid#65845PurposeMammalian expression of the wild type N terminal part (N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
TagsGFPExpressionMammalianMutationWT TransmembraneAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
p3E-H2B-mCerulean3-P2A-mKOFP2-CAAX
Plasmid#75177PurposeNuclear mCerulean3 (blue) fluorophore and a membrane targeted KOFP2 (orange) fluorophore separated by a self-cleaving 2A peptide for use with C-terminal fusions.DepositorInsertH2B-mCerulean3-P2A-mKOFP2-CAAX
UseThree prime entry vector for multisite gateway th…Promotern/aAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-PH-citrine
Plasmid#131406PurposePurpose: synthesis of mRNA encoding a membrane marker. Insert: PH domain of the human phospholipase C delta 1 (PLCD1) fused with the yellow fluorescent protein mCitrineDepositorInsertPH
UseIn vitro transcriptionTagscitrine yellow fluorescent proteinPromoterT7Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSETa-Amrose v1
Plasmid#79537PurposepRSETa (Invitrogen) plasmid expressing Amrose variant 1DepositorInsertAmrose
Tags6xHis, T7 epitope, and Xpress tagExpressionBacterialPromoterT7Available SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BLRR
Plasmid#158958PurposeBioluminescent repair reporter (BLRR) for DNA double strand break (DSB) repairs: homology-directed repair (HDR) and non-homologous end joining (NHEJ).DepositorInsertBLRR
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Bystin
Plasmid#11869DepositorInsertBystin (BYSL Human)
ExpressionMammalianAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-NHP.RMA-IRES-EGFP
Plasmid#227887PurposeExpresses Gluc-NHP.RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-NHP.RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to macaque Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-H19A_V
Plasmid#147799PurposeMammalian Expression of HsDCP1a-H19ADepositorInsertHsDCP1a-H19A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-N74G_V
Plasmid#147800PurposeMammalian Expression of HsDCP1a-N74GDepositorInsertHsDCP1a-N74G (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-Q18AH19A_V
Plasmid#147801PurposeMammalian Expression of HsDCP1a-Q18AH19ADepositorInsertHsDCP1a-Q18AH19A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-R72G_V
Plasmid#147802PurposeMammalian Expression of HsDCP1a-R72GDepositorInsertHsDCP1a-R72G (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-R72GN74G_V
Plasmid#147803PurposeMammalian Expression of HsDCP1a-R72GN74GDepositorInsertHsDCP1a-R72GN74G (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP2_1-244_V
Plasmid#147790PurposeMammalian Expression of HsDCP2_1-244DepositorInsertHsDCP2_1-244 (DCP2 Human)
ExpressionMammalianMutationone silent mutation A429G compared to the sequenc…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-HsEDC4_977-1401-HsDCP2_395-420_K
Plasmid#146809PurposeBacterial Expression of HsEDC4_977-1401-HsDCP2_385-420DepositorInsertHsEDC4_977-1401-HsDCP2_385-420 (EDC4 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only