We narrowed to 15,064 results for: NTS
-
Plasmid#185385PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in mammalian cellsDepositorInsertGPCR activation based oxytocin control sensor GRAB_OTmut
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf37
Plasmid#12725PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf37
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf48
Plasmid#12736PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf48
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-Mito-7
Plasmid#56508PurposeLocalization: Mitochondria, Excitation: 493, Emission: 509DepositorAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-EWS_1-264
Plasmid#180467PurposeExpresses the construct His8-EWS_1-264 with a TEV cleavage site for the removal of the His8 tagDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-POLArISact
Plasmid#164970PurposeT7 promotor drives in vitro transcription of POLArISact with a human kozak sequenceDepositorInsertPOLArISact
UseIn vitro transcriptionPromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-GFP-mSox2
Plasmid#206374PurposeExpresses EGFP fused mouse SOX2 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
tdp43-EGFP construct9
Plasmid#28202DepositorAvailable SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only