We narrowed to 10,180 results for: yeast
-
Plasmid#81097PurposeGene Tagging vector URA/iRFP - Plasmid for tandem infrared RFP (tdiRFP) labeling of endogenous proteins with a URA selection marker, originating from pSIVu (ID:81089)DepositorInserttdiRFP
UseCre/LoxTagstdiRFPExpressionYeastAvailable SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDZ584 pKAN 1x-mCherry
Plasmid#73172PurposeFloxed Kanamycin (G418) selection maker; 3' tagging vector used to create C-terminal fusion proteins with 1x-mCherryDepositorInsert1x-mCherry
UseUnspecifiedAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNB786
Plasmid#60151PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion driven by LEU1 promoter.DepositorInsertFLuc-yEVenus
ExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterLEU1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNB682
Plasmid#60143PurposeFirefly luciferase (Promega) and yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by MET17 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationA4VPromoterMET17prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Gal4pBS134-Pleum
Plasmid#60339PurposeContains a promoter of three gal binding sites derived from native galactose promoter coupled with a core promoter derived from native Leucine promoter.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable SinceFeb. 11, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
MET FLAG72QDProCFPp303
Plasmid#15590DepositorInserthtt 72Q Delta Pro (HTT Human)
TagsCFP and FLAGExpressionYeastMutationProline-rich region removedAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
pJLI-Sup35N-KDG6-C
Plasmid#1238DepositorInsertSUP35 (SUP35 Budding Yeast)
UseYeast integrative plasmidMutationSUP35 middle region (aa124-253) was replaced with…Available SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pCAS9i_TRP
Plasmid#141253PurposeGalactose-inducible expression of Cas9 for addressing one target; Contains guide RNA expression cassette with stuffer and KpnI-Pme1 restriction sites.DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterGAL1 (Cas9), pSNR52 (gRNA)Available SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p416-GPD-PRUNE-HA
Plasmid#183945PurposeExpresses human HA-tagged PRUNE from yeast GPD promoterDepositorAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pBCSK_HIS3_II
Plasmid#109059Purposeyeast shuttle vector with deletable CEN6-ARSH4 cassette. For teaching purposes.DepositorInsertHIS3 (HIS3 Zygosaccharomyces rouxii, Budding Yeast)
UseCre/LoxExpressionBacterial and YeastPromoterHIS3Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBCSK_HIS3_I
Plasmid#109058Purposeyeast shuttle vector with deletable CEN6-ARSH4 cassette. For teaching purposes.DepositorInsertHIS3 (HIS3 Zygosaccharomyces rouxii, Budding Yeast)
UseCre/LoxExpressionBacterial and YeastPromoterHIS3Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH340-SUP45(1-242)-GalBD
Plasmid#29740DepositorInsertSUP45 (SUP45 Budding Yeast)
TagsGal Activation domain and MycExpressionYeastMutationCodons 1-242 of the yeast SUP45 gene onlyAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
Sc Pol1-FLAG-pRS402/GAL-L
Plasmid#241975PurposeOver-express Sc Pol1-FLAG (Sc pol alpha - large subunit) in yeast (integrated)DepositorAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-S6-RFC1-pRS405/GAL-L
Plasmid#239473PurposeOverexpress Sc FLAG-S6-RFC1 in yeast (integrated)DepositorAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
TINGL pDRF1
Plasmid#226436PurposeExpresses TINGL (mTq2-based glucose sensor) in yeastDepositorInsertTINGL
ExpressionYeastPromoterPMA1Available SinceDec. 2, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-HA-PPK(mutant)
Plasmid#183944PurposeExpresses HA-tagged catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli)
TagsHAExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_MET16
Plasmid#166091PurposePlasmid for constituive spCas9 and tet-inducible MET16 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMay 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_1
Plasmid#166074PurposePlasmid for constituive spCas9 and tet-inducible CPR1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GAL7
Plasmid#166089PurposePlasmid for constituive spCas9 and tet-inducible GAL7 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GLK1
Plasmid#166090PurposePlasmid for constituive spCas9 and tet-inducible GLK1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LHS1
Plasmid#166092PurposePlasmid for constituive spCas9 and tet-inducible LHS1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only