We narrowed to 59,430 results for: SAP
-
Plasmid#192493PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAP102 [N19/2-rat IgG2a] - Chimeric
Plasmid#227076PurposeMammalian expression plasmid of anti-SAP102 (Rattus norvegicus) rat IgG2a R-mAb. Derived from hybridoma N19/2.DepositorInsertAnti-SAP102 (Rattus norvegicus) recombinant mouse monoclonal antibody. (Dlg3 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAP97 [K64/15-rat IgG2a] - Chimeric
Plasmid#227077PurposeMammalian expression plasmid of anti-SAP97 (Rattus norvegicus) rat IgG2a R-mAb. Derived from hybridoma K64/15.DepositorInsertAnti-SAP97 (Rattus norvegicus) recombinant mouse monoclonal antibody. (Dlg1 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp+exon_siResist minimal CMV pCDNA5
Plasmid#212085PurposeLR vector for integration of Sap30bp+exon(48nt)_siResist into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp+exon(48nt)_siResist (Sap30bp Mouse)
UseTagsExpressionMammalianMutationTCTAACCATCTGCAGGACAPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212084PurposeLR vector for integration of Sap30bp-exon_siResist into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp-exon_siResist (Sap30bp Mouse)
UseTagsExpressionMammalianMutationTCTAACCATCTGCAGGACAPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp+exon minimal CMV pCDNA5
Plasmid#212073PurposeLR vector for integration of Sap30bp+exon(48nt) into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp+exon(48nt) (Sap30bp Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212072PurposeLR vector for integration of Sap30bp-exon into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp-exon (Sap30bp Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBC-SV40NLS-PfV-Sapphire-IRES-H2B-mCherry
Plasmid#203652PurposeMammalian lentiviral vector for the expression of the Sapphire-tagged nuclear localizing 40nm nucGEMs under the UBC promoter, with a secondary translation initiation site for H2B-mCherry expression.DepositorArticleInsertPfV
UseLentiviralTagsSapphire-IRES-H2B-mCherryExpressionMutationPromoterAvailable sinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVTagsExpressionMutationNoPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-T2A-mCherry-pA
Plasmid#192481PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterU6/EFSAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-CasRx-pA
Plasmid#233038PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
5'-BirA-FLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212092PurposeLR vector for integration of Sap30bp-exon into N2a FRT rtTA3 expression cells (BioID vector)DepositorInsertSap30bp-exon (Sap30bp Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-BirA-FLAG Sap30bp+exon minimal CMV pCDNA5
Plasmid#212093PurposeLR vector for integration of Sap30bp+exon(48nt) into N2a FRT rtTA3 expression cells (BioID vector)DepositorInsertSap30bp+exon(48nt) (Sap30bp Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHS0535 CRISPR-associated IscB (Chesapeake Bay) in pBR322 with Fn spacer
Plasmid#176589PurposeEndogenous locus of CRISPR-associated IscB (Chesapeake Bay) with Fn spacerDepositorInsertCRISPR-associate IscB (Chesapeake Bay) locus
UseTagsExpressionBacterialMutationTruncated CRISPR array to two direct repeats, rep…PromoterAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-hfCas13d-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233046PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d and mCherry
UseTagsmCherryExpressionMammalianMutationPromoterAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-CasRx-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233045PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx and mCherry
UseTagsmCherryExpressionMammalianMutationPromoterAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsert2xHA-CAMSAP3 (Camsap3 Mouse)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGW045 AAV-CRISPRa base vector pAAV_OE-U6sgbbSapI(MS2)-EF1a-MPH-WPRE
Plasmid#192161PurposeAAV-CRISPRa base vectorDepositorTypeEmpty backboneUseAAVTagsExpressionMutationNAPromoterAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only