We narrowed to 2,745 results for: EXO
-
Plasmid#88851PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only
-
Hy_pMT Laccase2 MCS-HIPK3 Exon
Plasmid#69888PurposeExpresses the human HIPK3 exon 2 circular RNA in DrosophilaDepositorInsertHIPK3 (HIPK3 Human, Fly)
ExpressionInsectMutationExpresses aa1-194 of HIPK3PromoterMetallothionein Promoter (pMT)Available SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 CMV 3xFLAG ERN1 ∆exon18
Plasmid#250300PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of 3xFLAG-tagged exon-18 skipping ERN1DepositorAvailable SinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
NSK250 CMV-TO-SCN1A (exons 20, 20N, 21)
Plasmid#247285PurposeExpresses human SCN1a exons 20, 20N, 21DepositorAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC6 (pP18(T)_B11-AVA4069)
Plasmid#239304PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC6DepositorInsertU6-driven sgRNA targeting EXOSC6 (EXOSC6 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC7 (pP18(T)_C4-AVA4066)
Plasmid#239305PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC7DepositorInsertU6-driven sgRNA targeting EXOSC7 (EXOSC7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC2 (pP18(T)_C3-AVA4067)
Plasmid#239301PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC2DepositorInsertU6-driven sgRNA targeting EXOSC2 (EXOSC2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-E-cadherin(Canis)-exon1 6-28 gRNA
Plasmid#209922PurposeA knock-out vector for the dog CDH1DepositorInsertA gRNA targeting the dog CDH1 gene.
UseCRISPR and LentiviralAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1b) [N212A/34R-2b]
Plasmid#225413PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse) IgG2b R-mAb. Derived from hybridoma N212A/34.DepositorInsertAnti-TRIP8b (exon 1b) (Mus musculus) recombinant (Mouse) monoclonal antibody. (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a-5) [N291A/43R]
Plasmid#225389PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a-5) (Mouse) IgG2a R-mAb. Derived from hybridoma N291A/43.DepositorInsertAnti-TRIP8b (exon 1a-5) (Mus musculus) recombinant (Mouse) monoclonal antibody. (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-MFF (exon 1) [N382/69R]
Plasmid#206565PurposeMammalian Expression Plasmid of anti-MFF (exon 1) (Human). Derived from hybridoma N382/69.DepositorInsertanti-MFF (exon 1) (Homo sapiens) recombinant Mouse monoclonal antibody (MFF Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1b) [N212A/34R]
Plasmid#182108PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse). Derived from hybridoma N212A/34.DepositorInsertanti-TRIP8b (exon 1b) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a/5) [N291C/22R]
Plasmid#114563PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a/5) (Mouse). Derived from hybridoma N291C/22.DepositorInsertanti-TRIP8b (exon 1a/5) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 40a
Plasmid#87894Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 5a, 17, 40a
Plasmid#87895Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 5a, 17, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 40a
Plasmid#87901Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1a, 17, 40a
Plasmid#87899Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1a, 17, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 17, 40a
Plasmid#87891Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 17, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene
Plasmid#169273PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 WT minigeneDepositorAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 GT>A minigene
Plasmid#169274PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 GT>A minigeneDepositorInsertRBM28 Exon1-6 GT>A minigene (RBM28 Human)
ExpressionMammalianMutationNM_018077.2:c.(541+1_541+2delinsA)PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Med24-exon minimal CMV pCDNA5
Plasmid#212060PurposeLR vector for integration of Med24-exon into N2a FRT rtTA3 expression cellsDepositorInsertMed24-exon (Med24 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Med24+exon minimal CMV pCDNA5
Plasmid#212061PurposeLR vector for integration of Med24+exon(57nt) into N2a FRT rtTA3 expression cellsDepositorInsertMed24+exon(57nt) (Med24 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Zmynd8+exon minimal CMV pCDNA5
Plasmid#212079PurposeLR vector for integration of Zmynd8+exon(48nt) into N2a FRT rtTA3 expression cellsDepositorInsertZmynd8+exon(48nt) (Zmynd8 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Kdm1a-exon minimal CMV pCDNA5
Plasmid#212054PurposeLR vector for integration of Kdm1a-exon into N2a FRT rtTA3 expression cellsDepositorInsertKdm1a-exon (Kdm1a Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-Phi29(+exo) (LM2759)
Plasmid#208964PurposeUnfused Phi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertPhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianPromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Chtop-exon minimal CMV pCDNA5
Plasmid#212080PurposeLR vector for integration of Chtop-exon into N2a FRT rtTA3 expression cellsDepositorInsertChtop-exon (Chtop Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
tau exon 9–12 FTDP-17 N279K splicing minigene
Plasmid#122967Purposeexpresses circular tau RNAs with the FTDP-17 N279KDepositorInsertmaps
ExpressionMammalianMutationFTDP-17 mutationAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct1-LexA-VP16-VAMP2 + LexO-YFP
Plasmid#240975PurposeExpresses membrane-anchored transcription factor (LexA-VP16) in yeast, along with YFP reporter under LexO promoterDepositorInsertLexA-VP16-VAMP2, LexO::YFP
ExpressionYeastAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSK163 CMV-TO-SMN2 Nluc - active (exon 6, 7, 8)
Plasmid#247276PurposeExpresses human SMN2 exons 6, 7, 8 followed by NlucDepositorInsertSMN2 exons 6,7,8-Nluc (SMN2 Human)
ExpressionMammalianMutation"A" insertion at position 49 of exon 7PromoterCMV-TOAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only