We narrowed to 1,485 results for: U6 promoter
-
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-CjeCas9-sgRNA (KAC482)
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
ExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
ExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorArticleInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralExpressionMammalianPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-[BsmBI_pegRNA_entry]-tevopreQ1-term (LM1138)
Plasmid#223137PurposepU6 entry plamid for cloning prime editor tevopreQ1 epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertetevopreQ1 entry plasmid backbone for epegRNA expression via human U6 promoter
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
Plasmid#117134PurposeAll-in-one expression vector for Cas9 and gRNA against CD44DepositorInsertgCD44 v2 (Cd44 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, human EF1a promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1, PolyU(0)
Plasmid#166992PurposeTests for the impact of a synthetic linear tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination module:PolyU(0)
ExpressionMammalianAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri-U6-Camk2d sgRNA7
Plasmid#220127PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauriCas9
UseAAVTagsHA tagPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Nkx2-5
Plasmid#117137PurposeExpression vector encoding BFP-BSD-Nkx2-5DepositorInsertNkx2-5 CDS (Nkx2-5 Mouse)
UseLentiviralExpressionMammalianMutationmodified BFPPromoterhuman U6 promoter, human EF1a promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-human U6-sgRNA-EF1Alpha-puro-T2A-BFP
Plasmid#118594PurposeParental vector for the CRISPRa libraries. Expresses an sgRNA from the human U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertsgRNA/Puro-T2A-BFP
UseLentiviralExpressionMammalianPromoterEF1AlphaAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only