168,189 results
-
Plasmid#74285PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette and GFP, for cloning into AscIDepositorInsertRosa26 5-homology region
UseMouse TargetingAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-GFP-cytoB5RR
Plasmid#182577PurposeExpresses LifeAct-GFP targeted to the ER via the CytB5RR tail anchor sequenceDepositorInsertLifeAct-GFP-cytoB5RR
TagsLifeAct and cytoB5RRExpressionMammalianAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FAH-rtTA3G
Plasmid#120309PurposeAn AAV vector that expresses rtTA3G under the c-fos promoterDepositorInsertrtTA3G
UseAAVPromoterc-fosAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3232
Plasmid#144708PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB402SC
Plasmid#224552PurposeEmpty, Gateway-compatible expression vector for transient transformation of N. benthamiana leaves. Vector backbone encodes C-terminal Twin-Strep-HA tags. Duplicated 35S promoter and 35S terminator.DepositorTypeEmpty backboneTagsTwin-Strep-HAExpressionPlantPromoter2 X 35SAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ymTurquoise2-Kan
Plasmid#224092PurposeYeast tagging vector to create a gene fusion with yeast optimized mTurquoise2 with Kan selectionDepositorInsertymTurquoise2
TagsymTurquoise2ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
G13-CASE
Plasmid#168127PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G13. Composed of the subunits G alpha 13 (GNA13) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F125/D126 within GNA13Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
PET01-TAF5-ex8-Minigene-SRSF1 motif WT
Plasmid#218972PurposeVector for constitutive expression of TAF5 alternative exon-8 mini gene with wild type SRSF1 motif (TCAGAGGA)DepositorInsertTAF5 exon-8 (with wild type SRSF1 motif )and the native flanking intronic sequences spanning the exon-8
ExpressionMammalianPromoterRSV LTRAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
2C-3XtbGFP-PEST
Plasmid#69072PurposeExpresses 3XturboGFP-NLS-PEST under MERVL_LTRDepositorInsertturboGFP
ExpressionMammalianAvailable SinceSept. 16, 2015AvailabilityAcademic Institutions and Nonprofits only