We narrowed to 7,192 results for: aav
-
Plasmid#244072PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Grx1-RoTq-On
Plasmid#234467PurposeMammalian expression of Grx1-RoTq-OnDepositorInsertGrx1-RoTq-On
UseAAVExpressionMammalianAvailable SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry
Plasmid#50459PurposeDouble floxed mCherry under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertmCherry
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry
Plasmid#50476PurposeGq-coupled hM3D DREADD fused with mCherry under the control of CaMKIIa promoterDepositorHas ServiceAAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry (CHRM3 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterCaMKIIaAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-pAce-Kv2.1PR
Plasmid#195529PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NDi-CRISPRi (Gen2)
Plasmid#73498PurposeDox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locusDepositorInsertsdCas9-KRAB
rtTA
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAG and TRE3GAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Lck-mTagBFP2
Plasmid#234537Purposeto label the membrane of cells with a fluorescent protein (mTagBFP2)DepositorInsertLck-mTagBFP2
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sasgRNACMV- mCherry-WPREpA
Plasmid#217015PurposeS. aureus sgRNAs backbone along with mCherry expressionDepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry
Plasmid#50475PurposeGi-coupled hM4D DREADD fused with mCherry under the control of human synapsin promoter.DepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM4D(Gi)-mCherry
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ADP-MCS-FLAG
Plasmid#192360PurposeAdipocyte-specific overexpression of genesDepositorTypeEmpty backboneUseAAVTags3xflagExpressionMammalianPromoteradiponectin promoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-jGCaMP8s-WPRE
Plasmid#179256PurposeAAV-mediated expression of GCaMP8s under the CAG promoterDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertjGCaMP8s
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE C-terminal
Plasmid#137176PurposeAAV genome: expresses the C-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE C-terminal; U6-protospacer
UseAAVPromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AP.Adamts2.1-GFP-WPRE
Plasmid#211488Purposeexpresses GFP under artificial promoter Adamts2DepositorInsertGFP
UseAAVAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE N-terminal
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Pur-CAG-EGFP
Plasmid#80945Purposehuman AAVS1 site targeting donor plasmid for knocking-in EGFP expression cassette driven by CAG promoterDepositorInsertEGFP
ExpressionMammalianPromoterCAG promoterAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry
Plasmid#50474PurposeGq-coupled hM3D DREADD fused with mCherry under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry (CHRM3 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BRX-eGFP-NLS
Plasmid#217534PurposeAAV vector to drive the expression of eGFP under the control of the 4xBRE regulatory element of SMAD1 and miniXon splicing casette transcription factor in vivoDepositorArticleInsertBMP reporter element and miniXon casette (Smad1 Mouse)
UseAAVExpressionMammalianPromoterBMP Reporter ElementAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only