We narrowed to 2,448 results for: ara-2
-
Plasmid#176888PurposeFar-red fluorescent zinc indicator FRISZ in pTorPE vectorDepositorInsertFRISZ
TagsPeriplasmic expression TorA tag and Twin-Strep-taā¦ExpressionBacterialPromoteraraBAD promoterAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRoDonor
Plasmid#178773PurposeExpression of RoCAST left end, cam, RoCAST right end from Rippkaea orientalisDepositorInsertRoCAST left end, cam, RoCAST right end from Rippkaea orientalis
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) mEOS2 hYAP 1-2delta
Plasmid#124162PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-2beta
Plasmid#124144PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAEM7
Plasmid#136422PurposesalL gene from S. tropica CNB-440 ligated into pHIS8DepositorInsertsalL
TagsHis8 tagExpressionBacterialPromoterT7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH34
Plasmid#126008PurposeLevel0 Arabidopsis AtU6-26 Pol III promoterDepositorInsertLevel0 Arabidopsis AtU6-26 Pol III promoter
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH-HT_CtCHAD-H253A-R256A-R260A-R296A-R418A-Y419A
Plasmid#127790PurposeExpresses a CtCHAD mutant protein in E. coli cellsDepositorInsertCtCHAD (CT0884 Chlorobium tepidum)
Tags6xHis tag + TEV cleavage siteExpressionBacterialMutationResidues 208-522 (CHAD domain), mutations in His2ā¦Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTM_Sumo2-N-8XHis-Plpro-C111S
Plasmid#234472PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 C111S with an activity abolishing mutation for the purification of this PLpro protease. Following Sumo Protease Cleavage an N-term 8xHis Tag is retainedDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGTM_Sumo_PLpro_C111A
Plasmid#234489PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of PLpro protease with a C111A active site mutation that abolishes protease activity. Following Sumo Protease cleavage no nonnative resDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGTM_SUMO_PLpro_C111S
Plasmid#233740PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of PLpro protease with a C111S active site mutation that abolishes protease activity. Following Sumo Protease cleavage no nonnative resDepositorInsertPLpro (ORF1ab SARS-CoV-2)
Tags6xHis-SumoExpressionBacterialMutationCys111Ser active site mutation of the Papain-Likeā¦PromoterT7 lacAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pT2U2-YFP
Plasmid#84544PurposeHybrid reporter construct with 4 transcription factor binding sites (2 TetO, 2 UAS) driving EYFPDepositorInsertT2U2-EYFP
ExpressionMammalianPromoterCMV-minAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU2T2-YFP
Plasmid#84543PurposeHybrid reporter construct with 4 transcription factor binding sites (2 UAS, 2 TetO) driving EYFPDepositorInsertU2T2-EYFP
ExpressionMammalianPromoterCMV-minAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CHAC1-promoter-WT-GFP
Plasmid#255523PurposeTo determine CHAC1 promoter activityDepositorInsertCHAC1 promoter
TagsEGFPExpressionMammalianAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYTK014
Plasmid#65121PurposeEncodes pTEF2 as a Type 2 part to be used in the Dueber YTK systemDepositorInsertpTEF2
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK023
Plasmid#65130PurposeEncodes pRNR2 as a Type 2 part to be used in the Dueber YTK systemDepositorInsertpRNR2
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK025
Plasmid#65132PurposeEncodes pRAD27 as a Type 2 part to be used in the Dueber YTK systemDepositorInsertpRAD27
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK026
Plasmid#65133PurposeEncodes pPSP2 as a Type 2 part to be used in the Dueber YTK systemDepositorInsertpPSP2
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK030
Plasmid#65137PurposeEncodes pGAL1 as a Type 2 part to be used in the Dueber YTK systemDepositorInsertpGAL1
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK011
Plasmid#65118PurposeEncodes pPGK1 as a Type 2 part to be used in the Dueber YTK systemDepositorInsertpPGK1
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only