We narrowed to 3,974 results for: yfp
-
Plasmid#41013DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsTEV-YFP-FlagExpressionMammalianMutationchanged amino acids 1189-1192 to AlanineAvailable sinceNov. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT-DEST EVC2ala5-TEV-YFP-Flag
Plasmid#41012DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsTEV-YFP-FlagExpressionMammalianMutationchanged amino acids 1185-1188 to AlanineAvailable sinceNov. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT-DEST EVC2ala4-TEV-YFP-Flag
Plasmid#41011DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsTEV-YFP-FlagExpressionMammalianMutationchanged amino acids 1183-1186 to AlanineAvailable sinceNov. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available sinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Elf5-KI-3'UTR-2A-EYFP-NLS
Plasmid#128833PurposeKnock-in of nuclear EYFP into mouse Elf5 locusDepositorInsertNuclear EYFP into Elf5 locus (Elf5 Mouse)
UseMouse TargetingAvailable sinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSin wPGK-Cre
Plasmid#101242Purposelow-efficiency Cre used to turn on dio YFP/ PSD95-mCherry/ Teal-gephyrin expressionDepositorInsertCre recombinase
UseLentiviralMutationsee attached fileAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
proinsulin-EYFP
Plasmid#218952PurposeExpresses proinsulin fused to EYFP in bacteriaDepositorInsertproinsulin-EYFP
TagsproinsulinExpressionBacterialPromoterT5Available sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg7_H
Plasmid#146476PurposeMammalian Expression of HsSmg7DepositorInsertHsSmg7 (SMG7 Human)
ExpressionMammalianMutationone non silent mutation G2560A (V854I) and three …Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn_CapChR1_eYFP
Plasmid#188033PurposeExpresses CapChR1-eYFP in mammalian neuronsDepositorInsertCapChR1-eYFP
UseAAVTagseYFPMutationS63D, L132C, T159C and N258E mutations in CrChR2PromoterhSynAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFlox_N-Mau2_BSD_FKBPF36V_EYFP
Plasmid#163880PurposeAcute Depletion of Mau2-EYFPDepositorInsertMau2 (Mau2 Mouse)
ExpressionMammalianAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_RapACR_T111C_N248Q-EYFP
Plasmid#119197PurposeMammalian expression plasmid encoding fast anion channelrhodopsin mutant RapACR_T111C_N248QDepositorInsertAnion channelrhodopsin RapACR fast mutant T111C_N248Q
TagsEYFPExpressionMammalianMutationchanged threonine 111 to cysteine and asparagine …PromoterCMVAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP
Plasmid#103817PurposeSoluble BLInCR mock effector that is recruited to 'localizer' sites upon blue light illuminationDepositorAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FLS2-YFPc
Plasmid#87166Purposefluorescence complementation assayDepositorAvailable sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CAG-LMO1 (GLuc-ChR2-EYFP)
Plasmid#72888Purposefusion protein of Gaussia luciferase, Channelrhodopsin-2, and enhanced yellow fluorescent protein (luminopsin) for bioluminescent optogeneticsDepositorInsertGaussia luciferase, Channelrhodopsin-2, EYFP
ExpressionBacterial and MammalianPromoterCAGAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130997PurposeDouble floxed soma-targeted ChRmine-eYFP under the control of Ef1a promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterEf1aAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSET FLIPPi-30m
Plasmid#13556DepositorInsertFLIPPi T22A
TagsECFP and EYFPExpressionBacterialMutationT22A in binding proteinAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-minBG-SYFP2
Plasmid#236723PurposeSYFP2-taggedDepositorInsertSYFP2
UseAAVAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only