We narrowed to 3,965 results for: yfp
-
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Elf5-KI-3'UTR-2A-EYFP-NLS
Plasmid#128833PurposeKnock-in of nuclear EYFP into mouse Elf5 locusDepositorInsertNuclear EYFP into Elf5 locus (Elf5 Mouse)
UseMouse TargetingAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSin wPGK-Cre
Plasmid#101242Purposelow-efficiency Cre used to turn on dio YFP/ PSD95-mCherry/ Teal-gephyrin expressionDepositorInsertCre recombinase
UseLentiviralMutationsee attached fileAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
proinsulin-EYFP
Plasmid#218952PurposeExpresses proinsulin fused to EYFP in bacteriaDepositorInsertproinsulin-EYFP
TagsproinsulinExpressionBacterialPromoterT5Available SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg7_H
Plasmid#146476PurposeMammalian Expression of HsSmg7DepositorInsertHsSmg7 (SMG7 Human)
ExpressionMammalianMutationone non silent mutation G2560A (V854I) and three …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn_CapChR1_eYFP
Plasmid#188033PurposeExpresses CapChR1-eYFP in mammalian neuronsDepositorInsertCapChR1-eYFP
UseAAVTagseYFPMutationS63D, L132C, T159C and N258E mutations in CrChR2PromoterhSynAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFlox_N-Mau2_BSD_FKBPF36V_EYFP
Plasmid#163880PurposeAcute Depletion of Mau2-EYFPDepositorInsertMau2 (Mau2 Mouse)
ExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYFP-lacY-1
Plasmid#140138PurposeEvaluating the impact of feedback on information transmission of a genetic sensor.DepositorInsertlacY (lacY )
ExpressionBacterialAvailable SinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
BtGRK2-sYFP2
Plasmid#137778PurposeVisualization of GRK2DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_RapACR_T111C_N248Q-EYFP
Plasmid#119197PurposeMammalian expression plasmid encoding fast anion channelrhodopsin mutant RapACR_T111C_N248QDepositorInsertAnion channelrhodopsin RapACR fast mutant T111C_N248Q
TagsEYFPExpressionMammalianMutationchanged threonine 111 to cysteine and asparagine …PromoterCMVAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP
Plasmid#103817PurposeSoluble BLInCR mock effector that is recruited to 'localizer' sites upon blue light illuminationDepositorAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLS2-YFPc
Plasmid#87166Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET FLIPPi-30m
Plasmid#13556DepositorInsertFLIPPi T22A
TagsECFP and EYFPExpressionBacterialMutationT22A in binding proteinAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130997PurposeDouble floxed soma-targeted ChRmine-eYFP under the control of Ef1a promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterEf1aAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-minBG-SYFP2
Plasmid#236723PurposeSYFP2-taggedDepositorInsertSYFP2
UseAAVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-EYFP
Plasmid#172383PurposeProduction of RVdG-CVS-N2c viral vectors for cell-type specific trans-synaptic retrograde labeling.DepositorInsertEYFP
UseNeurotropic virusAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD292 ZF43x8-Compact_EYFP
Plasmid#138903PurposeEYFP reporter vector for the ZF43x8-Compact promoterDepositorInsertZF43x8-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x8-CompactAvailable SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only