We narrowed to 10,927 results for: cat.1
-
Plasmid#35119DepositorInsertcallys5MX3
UseYeast replicatingAvailable SinceSept. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSA50
Plasmid#35111DepositorInsertcalys5MX4
UseYeast replicatingAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCG_IFITM3-IRES_BFP
Plasmid#179960PurposeExpression vector for human IFITM3. Co-expresses BFP controlled by an IRES element.DepositorInsertIFITM3 (IFITM3 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MmSphk1
Plasmid#118599PurposeExpresses sphingosine kinase 1, which catalyzes the phosphorylation of sphingosine to form sphingosine 1-phosphate in miceDepositorInsertMus musculus sphingosine kinase 1
TagsFLAGExpressionYeastPromoterGAL1, 10Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
HsSPHK1
Plasmid#118091PurposeExpresses sphingosine kinase 1, which catalyzes the phosphorylation of sphingosine to sphingosine-1-phosphate (S1P)DepositorInsertHomo sapiens Sphingosine Kinase 1
TagsFLAGExpressionYeastPromoterGAL1, 10Available SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
human b1 ecto-pIRES
Plasmid#113387PurposeExpress human beta 1 ectodomain with secretion peptide, purification tags, and C-terminal claspDepositorInserthuman beta 1 ectodomain
TagsHis tagExpressionMammalianPromoterCMVAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCG_IFITM2-IRES_eGFP
Plasmid#179959PurposeExpression vector for human IFITM2. Co-expresses GFP controlled by an IRES element.DepositorAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-hCYP26A1P-E4-luciferase
Plasmid#135592PurposeShort form DNA fragment of human CYP26A1gene promoter (E4) in pGL3-Basic-luc vectorDepositorInsertShort form promoter of human CYP26A1 gene (E4)
PromoterHuman CYP26A1 promoter (Short Form, E4)Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
RS18960_pMQ30_KO_Kan
Plasmid#185393PurposeNon-replicating vector used to create markerless deletion of RR42_RS18960 in C. basilensis 4G11DepositorInsertsRR42_RS18960 upstream flanking homology region
RR42_RS18960 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS17060_pMQ30_KO_Kan
Plasmid#185396PurposeNon-replicating vector used to create markerless deletion of RR42_RS17060 in C. basilensis 4G11DepositorInsertsRR42_RS17060 upstream flanking homology region
RR42_RS17060 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS17055_pMQ30_KO_Kan
Plasmid#185398PurposeNon-replicating vector used to create markerless deletion of RR42_RS17055 in C. basilensis 4G11DepositorInsertsRR42_RS17055 upstream flanking homology region
RR42_RS17055 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-ELL2 pBacPAK8
Plasmid#15327DepositorInsertEleven Nineteen Lysine Rich in Leukemia 2 (ELL2 Human)
UseBaculovirus constructionTagsFLAGAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
RS02060_pMQ30_KO_Kan
Plasmid#185391PurposeNon-replicating vector used to create markerless deletion of RR42_RS02060 in C. basilensis 4G11DepositorInsertsRR42_RS02060 upstream flanking homology region
RR42_RS02060 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS28935_pMQ30_KO_Kan
Plasmid#185392PurposeNon-replicating vector used to create markerless deletion of RR42_RS28935 in C. basilensis 4G11DepositorInsertsRR42_RS28935 upstream flanking homology region
RR42_RS28935 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18965_pMQ30_KO_Kan
Plasmid#185394PurposeNon-replicating vector used to create markerless deletion of RR42_RS18965 in C. basilensis 4G11DepositorInsertsRR42_RS18965 upstream flanking homology region
RR42_RS18965 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18970_pMQ30_KO_Kan
Plasmid#185395PurposeNon-replicating vector used to create markerless deletion of RR42_RS18970 in C. basilensis 4G11DepositorInsertsRR42_RS18970 upstream flanking homology region
RR42_RS18970 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-N317P
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-DD-T6B-WT-YFP
Plasmid#235145PurposeExpresses the inducible T6B peptide fused with DHFR and YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertDHFR-fused T6B peptide
UseAAVPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-FLAG-HA-T6B-WT-YFP
Plasmid#235141PurposeExpresses the T6B peptide fused with YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertT6B peptide
UseAAVTagsFLAG/HAPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
RS35075_pMQ30_KO_Kan
Plasmid#185390PurposeNon-replicating vector used to create markerless deletion of RR42_RS35075 in C. basilensis 4G11DepositorInsertsRR42_RS35075 upstream flanking homology region
RR42_RS35075 downstream flanking homology region
nptII kanamycin resistance marker
ExpressionBacterialAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-GBA-N370S-tmpknot-epegRNA
Plasmid#214091PurposeLentiviral vector expressing epegRNA to induce GBA N370S mutationDepositorInsertGBA N370S epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZA1
Plasmid#158479PurposeEntry clone for Golden Gate assembly. Golden Gate compatible wild-type A. thaliana ZAR1 with STOP codonDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2_BeYDV geminino 1.0 (GB4480)
Plasmid#225436PurposeBeYDV LIR1:2nd intron+eGFP CDS+Ter35S+p35S+1st intron:LIR1 in alpha2. Deconstructed replicon that needs BeYDV Rep for circularization and, thus, replication and eGFP transcription.DepositorInsertBeYDV geminino 1.0
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUPD2_miniDFR-FRT-OCSterm-FRT-miniDFR (GB4642)
Plasmid#225430PurposeOCS terminator flanked by two flippase recognition target (FRT) sites located at position 112 of the SlDFR minimal promoterDepositorInsertminiDFR-FRT-OCSterm-FRT-miniDFR
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUPD2_miniDFR-att-OCSterm-att-miniDFR (GB4641)
Plasmid#225431PurposeOCS terminator flanked by two att sites of PhiC31 integrase located at position 112 of the SlDFR minimal promoterDepositorInsertminiDFR-att-OCSterm-att-miniDFR
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZA3
Plasmid#158481PurposeEntry clone for Golden Gate assembly. Golden Gate compatible A. thaliana ZAR1 L17E with STOP codonDepositorAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA2
Plasmid#158480PurposeEntry clone for Golden Gate assembly. Golden Gate compatible A. thaliana ZAR1 D489V with STOP codonDepositorAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA11
Plasmid#158489PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 L17E without STOP codonDepositorAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA9
Plasmid#158487PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 without STOP codonDepositorAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA4
Plasmid#158482PurposeEntry clone for Golden Gate assembly. Golden Gate compatible A. thaliana ZAR1 L17E/D489V with STOP codonDepositorAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA10
Plasmid#158488PurposeEntry clone for Golden Gate assembly. Golden gate compatible A. thaliana ZAR1 D489V without STOP codonDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-UFM1
Plasmid#134639Purposeexpression of HA-tagged human UFM1 wildtypeDepositorAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-(pos36)GFP
Plasmid#62937PurposeExpression of 6xHis-(+36)GFP in bacterial cellsDepositorInsert(pos36)GFP
Tags6xHis tagExpressionBacterialPromoterT7Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-(-30)GFP
Plasmid#62936PurposeExpression of 6xHis-(-30)GFP in bacterial cellsDepositorInsert(-30)GFP
Tags6xHis tagExpressionBacterialPromoterT7Available SinceMay 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRK5-FLAG-UFM1
Plasmid#134640PurposeExpression of FLAG-tagged human UFM1 wildtypeDepositorAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-Cre-6xHis
Plasmid#62939PurposeExpression of Cre-6xHis in bacterial of cellsDepositorInsertCre recombinase
Tags6xHis tagExpressionBacterialPromoterT7Available SinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
LEPG_shSik3.3974
Plasmid#125855PurposeRetroviral expression of mouse Sik3 shRNA with GFP and puromycin resistance geneDepositorInsertshRNA targeting Sik3
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2242
Plasmid#141986PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shIrak1-2
Plasmid#180398PurposeProducing AAV that encodes mouse Irak1 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only