We narrowed to 6,626 results for: GFP expression plasmids
-
Plasmid#105279PurposePlasmid for integration of iGFP-Ypt52 at TRP1.DepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCMV5-OCT-HA-eGFP
Plasmid#67484PurposeTargets HA-eGFP to mitochondrial matrixDepositorInsertOCT-HA-eGFP
ExpressionMammalianPromoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV3-OCT-HA-eGFP
Plasmid#67482PurposeTargets HA-eGFP to mitochondrial matrixDepositorInsertOCT-HA-eGFP
ExpressionMammalianPromoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF3-GFP
Plasmid#67391PurposeMammalian expression of hArf3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF5-GFP
Plasmid#67393PurposeMammalian expression of hArf5 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4D-GFP
Plasmid#67405PurposeMammalian expression of hArl4D with C-term GFP tagDepositorInsertARL4D (ARL4D Human)
TagsGFPExpressionMammalianMutationbp 272 A to C; N91T mutation; bp 327 T to G; sil…PromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pClneoEGFPC-let60 K16N
Plasmid#66861PurposeExpress GFP-tagged dominat negative let60, in which Lysine 16 is mutated to asparagine, in mammalian cellsDepositorInsertLet-60 (let-60 Nematode)
TagsGFPExpressionMammalianMutationLysine 16 is mutated to asparaginePromoterCMVAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmMTR-3
Plasmid#66113Purposeexpresses EGFP-tagged MTR-3 in Drosophila cellsDepositorAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA6-myc-BKαΔM-GFP-V5-His
Plasmid#255910PurposeComplementary plasmid for co-expression with BKαΔM module to form functional BK channels. BKα residues 94–651 are replaced by a flexible peptide linker and GFP is tagged at C-terminus.DepositorInsertKCNMA1 (partial) (KCNMA1 Human)
TagsEGFP-V5-6xHis and MycExpressionMammalianMutationresidues 94–651 are deleted and replaced by a fle…Available SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDM1515 NoxB
Plasmid#252035PurposeDictyostelium discoideum, safe haven knock-in plasmid for the act5 locus, C-terminal GFP taggingDepositorInsertNoxB
UseAmoebal expressionTagsGFPAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pmMBD1.2G (pc2845)
Plasmid#246849PurposeMammalian expression plasmid of mouse MBD1 N-terminus (aa396-636). C-terminal tagged to GFP.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pmGMBD1.3(pc2899)
Plasmid#246850PurposeMammalian expression plasmid of mouse MBD1 lacking the CXXC3 domain. N-terminal tagged to GFP.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGmMBD1.4 (pc3305)
Plasmid#246851PurposeMammalian expression plasmid of mouse MBD1 lacking the MBD domain (aa 75–636). N-terminal tagged to GFP.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGmMBD1.5 (pc3306)
Plasmid#246852PurposeMammalian expression plasmid of MBD domain and NLS of mouse MBD1. N-terminal tagged to GFP.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pmMBD1.7G (pc3343)
Plasmid#246870PurposeMammalian expression plasmid of full length MBD1 with pointmutations C289 and 292A. C-terminal tagged to GFPDepositorInsertMBD1 (Mbd1 Mouse)
TagsGFPExpressionMammalianMutationPointmutations C289,292APromoterCMVAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFRT-B-GPCNA (pc1274)
Plasmid#247001PurposeThis pFRT-B plasmid enables the creation of a stable mammalian cell line expressing GFP-tagged PCNADepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2 (pc4741 )
Plasmid#249083PurposeBacteria expression plasmid of GFP-MeCP2DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2-R168X (pc4742 )
Plasmid#249084PurposeBacteria expression plasmid of GFP tagged MeCP2-R168X (aa1-aa167)DepositorInsertMeCP2 (MECP2 Human)
TagsGFPExpressionBacterialMutationMeCP2-R168X (aa1-aa167)PromoterT7Available SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2-R255X (pc4743 )
Plasmid#249085PurposeBacteria expression plasmid of GFP tagged MeCP2-R255X (aa1-aa254)DepositorInsertMeCP2 (MECP2 Human)
TagsGFPExpressionBacterialMutationMeCP2-R255X (aa1-aa254)PromoterT7Available SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-AA195-428-GFP
Plasmid#247241PurposeA bacterial expression plasmid encoding Arl13b (aa195-428) with N-terminal His and GFP-taggedDepositorInsertArl13b (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdelete amino acids 1-194PromoterT7 PromoterAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-AA1-245-GFP
Plasmid#247240PurposeA bacterial expression plasmid encoding Arl13b (aa1-245) with N-terminal His and GFP-taggedDepositorInsertArl13B (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdeleted amino acids 246-428Promotert7Available SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p1.3
Plasmid#246884PurposeServes as rescue template for endogenous editing of G3BP1DepositorAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p1.32
Plasmid#246890PurposeServes as rescue template for endogenous editing of G3BP1DepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p1.29
Plasmid#246889PurposeServes as rescue template for endogenous editing of G3BP1DepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2∆C∆GR-G pc5086
Plasmid#229762PurposeMammalian expression plasmid of MBD2-∆C∆GR. N-terminus of MBD2 lacking the glycine/arginine rich domain: aa75-96. C-terminal tagged to GFPDepositorInsertMBD2 (Mbd2 Mouse)
TagsGFPExpressionMammalianMutationMBD2 lacking the C-terminus and glycine/arginine …PromoterCMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2-N∆GR-G pc5087
Plasmid#229763PurposeMammalian expression plasmid of MBD2-N∆GR. N-terminus of MBD2 lacking the glycine/arginine rich domain: aa75-96. C-terminal tagged to GFP.DepositorInsertMBD2 (Mbd2 Mouse)
TagsGFPExpressionMammalianMutationN-terminus of MBD2 lacking the glycine/arginine r…PromoterCMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2∆CC-G pc5088
Plasmid#229764PurposeMammalian expression plasmid of MBD2∆CC. Protein is lacking the coiled coil domain: aa 363-396. C-terminal tagged to GFP.DepositorInsertMBD2 (Mbd2 Mouse)
TagsGFPExpressionMammalianMutationProtein is lacking the coiled coil domain: aa 363…PromoterCMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2∆N∆CC-G pc5089
Plasmid#229765PurposeMammalian expression plasmid of MBD2∆N∆CC. Protein is lacking the coiled coil domain: aa 363-396 and the N-terminus: aa 1-152. C-terminal tagged to GFP.DepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2-C∆CC-G pc5091
Plasmid#229766PurposeMammalian expression plasmid of MBD2-C∆CC. C-terminus of MBD2 lacking the coiled coil domain: aa 363-396. C-terminal tagged to GFP.DepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ06-CRISPR-SOX17-E2-gRNA1
Plasmid#131051PurposeSOX17 Knock outDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ07-CRISPR-SOX17-E2-gRNA2
Plasmid#131052PurposeSOX17 Knock outDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ08-CRISPR-SOX17-E1-gRNA1
Plasmid#131053PurposeSOX17 Knock outDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-gfa2(B)3-GFP-WPRE-miR124T
Plasmid#245068PurposeFluorescent reporter gene with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP, miR124T site
UseLentiviralExpressionMammalianPromoterHuman gfa2(B)3 promoterAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Phogrin EGFP twin strep
Plasmid#245046PurposeSecretory granule purification using Phogrin EGFP-twin-strep markerDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-tdP2A-Frankenbody-FLAG-mScarlet3-IRESv4-HaloTag-tdMCP
Plasmid#241141PurposeExpresses Anti-GCN4 scFv-sfGFP, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent SunTag and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-GCN4 scFv
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHUE-Clu-α-tail-H7-GFP
Plasmid#232022PurposeExpression of a His6-Ubiquitin-Clu(228-262)-eGFP fusion proteinDepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHUE-Clu-α-tail-GFP
Plasmid#232020PurposeExpression of a His6-Ubiquitin-Clu(228-240)-eGFP fusion proteinDepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
EP001: pLenti CMV Blast::eGFP-RC-I-1-H11
Plasmid#209301PurposeExpression plasmid for RC-I-1-H11 (de novo virus-like particle designed by David Baker lab) with N-terminal eGFPDepositorInsertRC-I-1-H11
UseLentiviralTagseGFPAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
B8-pVTCB052
Plasmid#231302PurposePlasmid used for expression of AI-designed GFP protein B8 in E. coliDepositorInsertB8
ExpressionBacterialAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAHW/Joseph2-Multitagged Plasmid
Plasmid#226725PurposeValidates the expression and detection of epitope-tagged proteins of interest in Drosophila cells.DepositorInsertpAHW/Joseph2
UseDrosophila s2 cell expressionTagsHA, Myc, GFP, Flag, V5, 6xHisExpressionInsectPromoterAct5CAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry
Plasmid#208834PurposeControl plasmid expresses mCherry under the hSyn1 promoter with sgRNAs against LacZ and GFPDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cTNT-GFP-Palmd
Plasmid#216832Purposecardiomyocytes-specific plasmid, expressing Gfp and the coding sequence of mouse PalmdDepositorAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cTNT-NEXN-GFP
Plasmid#216835Purposecardiomyocytes-specific plasmid, expressing the coding sequence of mouse Nexn and GFP tagDepositorAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNAC2):GFP
Plasmid#218574PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 206nt, 207nt from CT to…Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNAC1):GFP
Plasmid#218575PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to CGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNAC3):GFP
Plasmid#218573PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 334nt, 335nt from AG to…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only