We narrowed to 7,908 results for: aav
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-mNeonGreen
Plasmid#191208PurposemNeonGreen expression under the control of TRE promotorDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTREAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-GFP
Plasmid#182737PurposeGFP expression under the control of CamKII promotorDepositorInsertGFP
UseAAVPromoterCamKIIAvailable sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV8R-12 Capsid
Plasmid#213968PurposeAAV packaging vector carrying AAV2 rep gene and Cap8R modified AAV8 capsid coding sequenceDepositorTypeEmpty backboneUseAAVAvailable sinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-SpyCas9
Plasmid#113034PurposeAAV vector for expression of SpyCas9 in mammalian cellsDepositorInsertSpyCas9
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAG AAV CMV Empty
Plasmid#242957PurposeEmpty AAV expression backboneDepositorTypeEmpty backboneUseAAVPromoterCMVAvailable sinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-Flex-Rev-TdTomato
Plasmid#122501PurposeCre-dependent TdTomato expression.DepositorInsertTdTomato
UseAAVPromoterCAGAvailable sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-BRIC
Plasmid#172341PurposeAAV transfer plasmid for BRIC (Bioluminescent Red Indicator for Calcium)DepositorInsertBRIC
UseAAVPromoterhSyn promoterAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CKAR3
Plasmid#238413PurposeAAV construct with CKAR3 expression under a human synapsin promotor and WPRE3 translation enhancer.DepositorInsertCKAR3 (PKC sensor)
UseAAVExpressionMammalianAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-cyto-iATPSnFR1.0
Plasmid#102553Purposeexpresses cytoplasmic ATP sensor in astrocytesDepositorInsertiATPSnFR1.0
UseAAVAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorPublicationInsertdCas9
UseAAVTagsVPR miniMutationdead Cas9Available sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1328 - pAAV EF1a HA-hM3D(Gq)
Plasmid#89149PurposeAn AAV packaging plasmid that expresses HA-tagged hM3D(Gq) excitatory DREADD from the EF1a promoter.DepositorInserthM3D(Gq)
UseAAVTagsHAExpressionMammalianPromoterEF1aAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBK1290-AAV-dSaCas9
Plasmid#223139PurposeAAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-CFL-SN
Plasmid#181740PurposeAAV vector for expressing CFL-SNDepositorInsertCFL-SN
UseAAVExpressionMammalianPromoterEF1alphaAvailable sinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry
Plasmid#213915PurposeAAV construct expressing mCherry-tagged channelrhodopsin-2 driven by Lamp5 interneuron-targeting enhancer. Alias: pAAV_WDL0003_ChR2_mCherryDepositorHas serviceAAV1 and AAV PHP.eBInsertChannelrhodopsin 2-mCherry
UseAAVAvailable sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-ProC3-Cre/mCherry
Plasmid#126006PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCre-2A-mCherry
UseAAVPromoterProC3Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-mNeonGreen
Plasmid#124102PurposeExpression of the fluorescent protein mNeonGreen in mammalian cellsDepositorInsertmNeonGreen
UseAAVExpressionMammalianMutationCodon usage was optimized for Homo SapiensPromoterUbCAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CREB
Plasmid#68550PurposeAAV expression of CREBDepositorInsertCREB
UseAAVTagsEGFPExpressionMammalianPromoterCMVAvailable sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-FLEX-SaCas9-U6-sgNts
Plasmid#159909PurposeMutagenesis of NtsDepositorInsertNts (Nts Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only