We narrowed to 19,290 results for: MUT
-
Plasmid#118711PurposeLentiviral TET-ON inducible GFP-Progerin C661S (Farnesylation mutant)DepositorInsertGFP-Progerin C661S (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationC661S farnesylation mutantPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1aH-PIK3CA H1047R
Plasmid#180031PurposeThis plasmid is in the pT3-EF1a vector without loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid can be used in LoxP mice.DepositorAvailable SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CDK4
Plasmid#116724PurposeLentiviral expression of CDK4DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CTCF
Plasmid#116728PurposeLentiviral expression of CTCFDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DAPK1
Plasmid#116727PurposeLentiviral expression of DAPK1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-BRAF-V600E
Plasmid#116204PurposeLentiviral expression of BRAF V600EDepositorAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NFIL3_WT_V5
Plasmid#82985PurposeGateway Donor vector containing NFIL3, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase-W159H-S238F
Plasmid#112203PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W159H and S238F mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W159H and S238F mutations, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialMutationW159H, S238FPromoterN/AAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-AKT3
Plasmid#116711PurposeLentiviral expression of AKT3DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only