We narrowed to 3,556 results for: Braf;
-
Plasmid#86374Purposeexpression of nfsB-CFPDepositorInsertnitroreductase
UseZebrafishTagsECFPAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
p140Tol2-Olactb:SABER
Plasmid#226829PurposeExpression of beta actin driven BFP and molecular barcode array for SABER-seq in zebrafish. Also contains heat-shock activated mCherry reporter and CreERT2.DepositorInsertsBFP-SABER
mCherry-t2A-CreERT2
UseZebrafish expressionPromoterOlactb and hsp70Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-NLS-TurboID
Plasmid#163849PurposeIn vitro transcription of nls-TurboID. Parton lab clone JSTDepositorInsertTurboID
UseIn vitro transcription of rnaTagsnlsAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tg (mpx:mCherry-2A-Rac2D57N)
Plasmid#58934Purposeexpresses dominant negative rac2 tagged with mcherry in neutrophilsDepositorInsertmcherry-2a-Rac2D57N (rac2 Zebrafish)
Tagsmcherry2aMutationchanged Aspartate 57 to AsparaginePromotermpxAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
p5E-mnx1
Plasmid#82402PurposeGateway-compatible zebrafish mnx1 promoterDepositorInsertmnx1 promoter
Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF-AncBE4max
Plasmid#138270PurposeExpression of AncBE4max-Cas9 Base-editor from an EF1a promoter.DepositorInsertAncBE4max
UseCRISPRExpressionMammalianMutationD10APromoterEf1aAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-TurboID
Plasmid#166570PurposeMultisite Gateway 3' entry clone for fusions onto the N-terminus of TurboID. Parton lab clone JSSDepositorInsertTurboID
UseMultisite gateway entry cloneAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-miniTurboID-EGFP
Plasmid#163847PurposeIn vitro transcription of miniTurboID-EGFP. Parton lab clone JRTDepositorInsertminiTurbo
UseIn vitro transcription of rnaTagsEGFPAvailable SinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-TarHom-Tol2-kanaR-cryaa-CFP
Plasmid#74151PurposeBAC targeting cassette for pTARBAC2 with kanaR selection marker and lens-specific transgenesis marker CeruleanDepositorInsertTol2-kanaR-cryaa-CFP
Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-BASU-NS
Plasmid#166565PurposeMultisite Gateway middle entry clone encoding BASU. Parton lab clone JRODepositorInsertBASU
UseMultisite gateway entry cloneAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-Ruby2-NS
Plasmid#166569PurposeMultisite Gateway middle entry clone encoding mRuby2. Parton lab clone DJADepositorInsertRuby2
UseMultisite gateway entry cloneAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-BASU-EGFP
Plasmid#163845PurposeIn vitro transcription of BASU-EGFP. Parton lab clone JRRDepositorInsertBASU
UseIn vitro transcription of rnaTagsEGFPAvailable SinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
5UAS zfSynaptophysin:GFP
Plasmid#74316PurposeA fusion of zebrafish synaptophysin to GFP under the control of 5UAS repeatsDepositorInsertsynaptophysin
TagsEGFPMutationQ12H and deletion of F13 (please see depositor co…Promoter5UASAvailable SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
UAS:TVA-mCherry
Plasmid#187823PurposeExpression of a fusion of the transmembrane protein TVA and the red fluorescent protein mCherry under UAS control.DepositorInsertTVA-mCherry
ExpressionBacterialPromoter5xUASAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
mpeg:lamp2-mCherry-stop; cmlc2:GFP
Plasmid#213740PurposeExpresses Lamp2-mCherry in the macrophage lineage of zebrafish with a green heart transgenesis markerDepositorInsertlamp2-mCherry
UseZebrafishPromotermpeg1.1Available SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSYC-97
Plasmid#31565DepositorInsertpCS4+-NLS-EGFP-P2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3E tdTomato
Plasmid#135210PurposeRed fluorescent tagDepositorInserttdTomato
UseSynthetic BiologyAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS-TarHom-Tol2-kanaR-cryaa-dsRed
Plasmid#74152PurposeBAC targeting cassette for pTARBAC2 with kanaR selection marker and lens-specific transgenesis marker dsRedDepositorInsertTol2-kanaR-cryaa-dsRed
Available SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only