We narrowed to 7,847 results for: aav
-
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-WPRE
Plasmid#130992PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX-ArchT-GFP
Plasmid#58851PurposeAAV-mediated expression of ArchT-GFP under the EF1a promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertArchT-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterEF1aAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-TVA(mChr)-W3SL
Plasmid#218754PurposeProvides AND intersectional (Cre+Flp) expression of TVA-mCherryDepositorInsertTVA-mCherry
UseAAVTagsmCherryPromoterhSynAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-HA-HCARD-P2A-mCitrine
Plasmid#228902PurposeFor AAV packaging and Cre-dependent expression of a peripherally restricted DREADDDepositorHas ServiceAAV8Inserthydroxycarboxylic acid receptor 2 (Hcar2 Mouse)
UseAAV and Synthetic BiologyTagsHA and P2A mCitrineExpressionMammalianMutationR108KPromoterChicken Beta ActinAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-eBFP2-NLS-pA
Plasmid#183800PurposeAAV vector to express nuclear localized eBFP2 from CMV promoterDepositorInserteBFP2-NLS
UseAAVTagsNLSAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin (Cre-OFF)
Plasmid#166611PurposeEncodes Cre-inactivated GFP-2A-Tetanus toxin light chain under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-BFP-sesRNA-tTA2-WPRE-pA
Plasmid#192070PurposeExpression of BFP, sesRNA in mammalian cells, with tTA2 as efRNA.DepositorInsertsesRNA for tdTom
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
132_pAAV-ProB2-CatCh-GFP-WPRE
Plasmid#125922PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB2Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS hOPM
Plasmid#112498PurposeHomologous recombination vector for dox-inducible overexpression of OTX2, PAX6, and MITF in AAVS locus.DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP2135 - pAAV-AiE2326m-minBG-iCre(R297T)-BGHpA
Plasmid#243044PurposeAiE2326m is an enhancer sequence designed to drive AAV-mediated transgene expression in specific populations of brain cells.DepositorInsertiCre(R297T)
UseAAVMutationMutation in 297th amino acidAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2-SNAP
Plasmid#208794PurposeFor AAV production to express C2-SNAP in astrocytesDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-GCaMP6f-AAV
Plasmid#182501PurposeGFAP-ER-GCaMP6f AAV: An AAV5 constructed for ER-GCaMP6f with astrocyte specific GFAP promotorDepositorInsertER localized P450
UseAAVAvailable SinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
p1195-pssAAV.U1a.hNme2Cas9
Plasmid#129534PurposeAAV vector expressing Nme2Cas9DepositorInserthuman codon-optimized Nme2Cas9
UseAAVTags2xNLS and NLS-3xHA-NLSPromoterU1aAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA1-GCaMP6s
Plasmid#126002PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProA1Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProD1-GCaMP6s
Plasmid#126005PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProD1Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-TVA66T-EGFP-B19G
Plasmid#64097PurposeExpresses TVA66T-EGFP-B19G under the synapsin promotorDepositorInsertTVA66T-EGFP-B19G
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromotersynapsinAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only