We narrowed to 9,870 results for: SUB;
-
Plasmid#211458PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation mutant control peptide (F1A)DepositorInsertFlotillin-1-palmitoylation mutant control peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationC34AAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sema4f.b-Fc-His
Plasmid#72159PurposeExpresses the extracellular region of the Sema4F, isoform b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Susd4(3.7)-EGFP-sv40
Plasmid#184413PurposeAAV expression of tTA from mouse sushi domain containing 4 (Susd4) gene promoter.DepositorInsertMouse Susd4 gene promoter-EGFP (Susd4 Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Susd4 geneAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-SAC1-HLx10
Plasmid#108137PurposeRecruitable SAC1 with extended linkerDepositorInsertmCherry:FKBP1A(3-108):[GGSA]4GG:SACM1L(1-520):[EAAAR]10:SACM1L(521-587) (SACM1L Human)
ExpressionMammalianMutationSACM1L(1-520):[EAAAR]10:SACM1L(521-587)PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET19b-MED17
Plasmid#15412DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
FUW-M2-PAK2 S20A
Plasmid#31664DepositorInsertp21-activated protein kinase 2 S20A (PAK2 Human)
UseLentiviralTagsM2ExpressionMammalianMutationChanged Serine 20 to AlanineAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-C-Kbp
Plasmid#178013PurposeBacterial expression of green fluorescent potassium indicator mNG-C-KbpDepositorInsertmNG-C-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Pa-Kbp
Plasmid#178014PurposeBacterial expression of green fluorescent potassium indicator mNG-Pa-KbpDepositorInsertmNG-Pa-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Hv-Kbp
Plasmid#178015PurposeBacterial expression of green fluorescent potassium indicator mNG-Hv-KbpDepositorInsertmNG-Hv-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-D-Kbp
Plasmid#178012PurposeBacterial expression of green fluorescent potassium indicator mNG-D-KbpDepositorInsertmNG-D-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-AP-His
Plasmid#71942PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST_FLAG-HUWE1_YH/GG
Plasmid#187123Purposemammalian cell expression of FLAG-HUWE1 Y355G/H356GDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(S, +)-AP-His
Plasmid#72023PurposeExpresses the Sema3F protein (truncated at cleavage site P1; ie, short and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn5.a-Fc-His
Plasmid#72107PurposeExpresses the entire Netrin 5, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 UBXN11
Plasmid#169017PurposeExpresses GST-UBXN11 (human) in bacteriaDepositorAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3c(L)-Fc-His
Plasmid#72141PurposeExpresses the Sema3C protein (truncated at cleavage site P3; ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30Xa-SBL1(160S)
Plasmid#66872PurposeExpresses WTsoybean lipoxygenase-1 160S with N-term HistagDepositorInsertsoybean lipoxygenase-1 wild type (NEWENTRY Glycine max)
TagsHistag from pET30Xa-LICExpressionBacterialMutationnonePromoterT7lacAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxnc1-Fc-His
Plasmid#72131PurposeExpresses the extracellular region of the PlexinC1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K227/230R
Plasmid#127135DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K230R
Plasmid#127134DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K227R
Plasmid#127133DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ntn3-Fc-His
Plasmid#72105PurposeExpresses the entire Netrin 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_BET1
Plasmid#111683PurposeMAC-tagged gene expressionDepositorInsertBET1 (BET1 Human)
ExpressionMammalianAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3c(S)-Fc-His
Plasmid#72142PurposeExpresses the Sema3C protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDARMO_CMVT_3xFLAG-HUWE1_H3962D
Plasmid#187131Purposemammalian cell expression of 3xFLAG-HUWE1 H3962DDepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_FBRL
Plasmid#111686PurposeMAC-tagged gene expressionDepositorInsertFBRL (FBL Human)
ExpressionMammalianAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3g.a(L)-AP-His
Plasmid#72025PurposeExpresses the Sema3G, isoform a protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4g-AP-His
Plasmid#72034PurposeExpresses the extracellular region of the Sema4G protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-AP-His
Plasmid#72029PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBSSK p85 alpha (delta SH3, iSH2)
Plasmid#13433DepositorInsertp85 alpha (delta SH3, iSH2) (PIK3R1 Human)
TagsFlagExpressionBacterialMutationFlag tags replacing both the SH3 and iSH2 domains.Available SinceNov. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_K214R_Keima
Plasmid#127143DepositorAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-HA-NEMO
Plasmid#27560DepositorAvailable SinceAug. 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
Neo1.h-AP-His
Plasmid#71970PurposeExpresses the extracellular region of the Neogenin 1, isoform h protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET15b-Fab1 (Francisella tularensis)
Plasmid#61690PurposeInducible expression of the FabI enzyme (enoyl reductase) from Francisella tularensisDepositorInsertenoyl-[acyl-carrier-protein] reductase (NADH)
TagsHisExpressionBacterialPromoterT7Available SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-Fc-His
Plasmid#72068PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVENUS-N1-FNTA
Plasmid#86859PurposeTo express FNTA with a Venus tag at C terminus.DepositorInsertFNTA (FNTA Human)
TagsVenusExpressionMammalianMutationThe sequence of the insert is isoform 2, which di…PromoterCMVAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only