We narrowed to 7,309 results for: aav
-
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP-Lck-PinkFlamindo
Plasmid#228394PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVPromotermGFAPAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-EGFP-WPRE
Plasmid#135428PurposeCan be used to express EGFP. Can also be used to create adeno-associated virus for delivery of the EGFP sequenceDepositorInsertEGFP
UseAAVExpressionMammalianPromoterEF1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-1P-Kv-WPRE
Plasmid#202612PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector for neuron-specific expression using the promoter hSynDepositorInsertJEDI-1P-Kv
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-CFL-SN
Plasmid#181740PurposeAAV vector for expressing CFL-SNDepositorInsertCFL-SN
UseAAVExpressionMammalianPromoterEF1alphaAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLEX-mCherry
Plasmid#178583PurposeCre-dependent expression of mCherry under the constitutive promoterDepositorInsertmCherry
UseAAVExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Myr_mCherry-2A-eGFP
Plasmid#194877PurposeRatiometric Myr/Palm_mCherry control probeDepositorInsertMyristoylated/Palmitoylated_mCherry-T2A-GFP
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(mCherry)
Plasmid#221604PurposeA recombinant AAV2 plasmid encoding the PiGM-Iq system with CRY2PHR, CIBN and mCherry as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (mCherry)
UseAAVMutationRGS2 1-53 truncationPromoterHuman SynapsinAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-ArchT-tdTomato
Plasmid#28305PurposeCre-dependent viral expression of ArchT-tdTomato for neuronal inhibitionDepositorHas ServiceAAV5InsertArchT-tdTomato
UseAAV and Cre/Lox; Adeno-associated virusTagstdTomatoExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin2b
Plasmid#124864PurposeMutagenesis of Grin2bDepositorInsertGrin2b (Grin2b Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria1
Plasmid#124853PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.IgK-NGR
Plasmid#196227PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6.shRNA-Sdc1-1376
Plasmid#195574PurposeExpresses shRNA to knockdown mouse Syndecan-1DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL5069 (pDonor(AAVS1),CRISPR_Pse)
Plasmid#200904PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016 with a splice acceptor-T2A-PuroR-T2A-eGFP cargo, and a CRISPR RNA under a U6 promoter. Total transposon size = 2,024 bp.DepositorInsertMini Tn7016 (AAVS1 NGS), PseCRISPR (tSL425)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synapsin-HaloCaMP1b-EGFP
Plasmid#138328Purposechemigenetic calcium indicatorDepositorHas ServiceAAV1 and AAV9InsertHaloCaMP1b
UseAAVTagsEGFP, His-tag, and Nuclear Exclusion SignalExpressionMammalianPromotersynapsinAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro
Plasmid#227269PurposeEmpty AAVS1 targeting donor for the insertion of Puro and a medium strength PGK promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2CpolyGly op GFP (NIID)
Plasmid#224356PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with an expansion (100x) of GGC repeats with codon optimization (NOT pure GGC repeats)DepositorInsertuN2C with a GGC repeat expansion (100x)
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intron (CAG)Available SinceFeb. 5, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-36: AAVS1-mEGFP (PGK)
Plasmid#114404PurposeHomology arms and linker-mEGFP sequence for internal insertion of PGK-mEGFP at the AAVS1 safe harbor location in human cells as a reporter for cytoplasmic mEGFPDepositorInsertAAVS1 Homology Arms with PGK driven mEGFP (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 4, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits