We narrowed to 2,675 results for: CCS
-
Plasmid#74995PurposeCFP-based BiFC vector for transient expression of CC (155-238) in plantsDepositorTypeEmpty backboneUseReporter plasmidTagsCFP (155–239)/CC155ExpressionPlantPromoterCaMV35SAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pET19b_4CL:P5SHb + STS:P6SHb
Plasmid#139792Purposeexpression of biosynthetic enzymes 4CL and STS in fusion with CCDepositorInserts4CL:P5SHb
STS:P6SHb
ExpressionBacterialAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET19b_4CL:P3S + STS:AP4S
Plasmid#139795Purposeexpression of biosynthetic enzymes 4CL and STS in fusion with CCDepositorInserts4CL:P3S
STS:AP4S
ExpressionBacterialAvailable SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET19b_4CL:P7SHb + STS:P8SHb
Plasmid#139793Purposeexpression of biosynthetic enzymes 4CL and STS in fusion with CCDepositorInserts4CL:P7SHb
STS:P8SHb
ExpressionBacterialAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET19b_4CL:P7S + STS:P8S
Plasmid#139794Purposeexpression of biosynthetic enzymes 4CL and STS in fusion with CCDepositorInserts4CL:P7S
STS:P8S
ExpressionBacterialAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET19b_4CL:P3S + STS:P4S
Plasmid#139789Purposeexpression of biosynthetic enzymes 4CL and STS in fusion with CCDepositorInsertbiosynthetic enzymes 4CL and STS in fusion with coiled-coil segments
ExpressionBacterialAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWPI-TFDP2
Plasmid#114300PurposeConstitutive expression of the TFDP2 proteinDepositorInsertTFDP2 (TFDP2 Human)
UseLentiviralAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide1
Plasmid#118162PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CRY2-TSS-guide3
Plasmid#125430PurposeCRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide1
Plasmid#118169PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide2
Plasmid#118170PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118163PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118164PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide3
Plasmid#118171PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
Plasmid#118155PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the hPGK promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118161PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide3
Plasmid#118175PurposeCRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CRY2-TSS-guide1
Plasmid#125428PurposeCRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CRY2-TSS-guide2
Plasmid#125429PurposeCRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only