We narrowed to 34,812 results for: CaS;
-
Plasmid#186447PurposeEncodes catalytically inactive Cas12a (D917A, E1006A) from F. novicida (type V-A)DepositorInsertdCas12a
UseCRISPRTagsExpressionMutationD917A, E1006APromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
SadCas9 KRAB
Plasmid#188504PurposeExpresses FLAG tagged SadCas9 KRABDepositorInsertdCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A/N580APromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
p276 eSpCas9_2gRNAs_hH11
Plasmid#164850PurposegRNA vector for targeting human H11 locusDepositorInsertgRNAs for targeting human H11 locus
UseTagsExpressionMammalianMutationPromoterU6Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
act5c-LbCas12a
Plasmid#140620PurposeUbiquitous expression of LbCas12a in DrosophilaDepositorInsertLbCas12a
UseCRISPRTagsExpressionInsectMutationPromoterAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6a
Plasmid#215819PurposeExpress CBE6a (with SpCas9) in mammalian cellsDepositorAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRTH
Plasmid#198541PurposeExpresses human codon-optimized SpCas9-NRTH and blasticidin resistance: EFS promoter-SpCas9-NRTH-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRTH
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET_StrepII_TEV_LIC_TniQ(PmcCAST)
Plasmid#224927PurposeTniQ expression plasmid for the co-purification of TnsC-TniQ complexDepositorInsertTniQ
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only