We narrowed to 6,913 results for: crispr cas9 plasmids
-
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
Plasmid#154429Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmidDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
UseCRISPR and LentiviralExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA0306
Plasmid#169452PurposepRS415-TEF1p-Cas9-CYC1t; Cas9 expression plasmidDepositorInsertCas9
ExpressionYeastPromoterTEF1pAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
phU6-gRNA
Plasmid#53188PurposeExpresses the S. pyogenes sgRNA from the human U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
phH1-gRNA
Plasmid#53186PurposeExpresses the S. pyogenes sgRNA from the H1 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman H1Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmU6-gRNA
Plasmid#53187PurposeExpresses the S. pyogenes sgRNA from the mouse U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromotermouse U6Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
ph7SK-gRNA
Plasmid#53189PurposeExpresses the S. pyogenes sgRNA from the 7SK promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman 7SKAvailable SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCfB8622
Plasmid#126912PurposePlasmid containing gRNA expression cassette targeting ADE2 in Saccharomyces cerevisiaeDepositorInsertADE2 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1-TagBFP2
Plasmid#124773PurposeLentiviral plasmid to co-express a guide RNA and TagBFP2DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
psLIB CMV
Plasmid#229953PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty CMV-driven cassette; users should clone gene of interest into shuttle plasmid prior to multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS252
Plasmid#73720PurposeSapTrap GFP + Cbr-unc-119 donor plasmidDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS291
Plasmid#73724PurposeSapTrap mCherry + Cbr-unc-119 donor plasmidDepositorInsertmCherry + Cbr-unc-119
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only