-
Plasmid#110154PurposeExpression of human BHLHE40 in mammalian cellsDepositorInsertBHLHE40 (basic helix-loop-helix family member e40) (BHLHE40 Human)
UseTagsHAExpressionMammalianMutationPromoterCMVAvailable sinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SaPE2
Plasmid#174817PurposeMammalian expression of SaCas9 prime editor 2DepositorInsertSaPE2
UseTagsSV40 bpNLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K(S441A/S445A)
Plasmid#110161PurposeExpression of human eEF2K (S441A/S445A) in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
UseTagsHAExpressionMammalianMutationS441A/S445APromoterCMVAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short
Plasmid#72552Purposeexpresses 3*FLAG tagged human NSD3-shortDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutationnonePromoterLTRAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SM
Plasmid#136578PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb1
Plasmid#162793PurposeCcnb1 shRNA in pMKO.1 retroviral vectorDepositorInsertCcnb1 shRNA (Ccnb1 Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterU6Available sinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-mEKLF
Plasmid#67833PurposeExpression of FL-EKLF driven by SV40 promoterDepositorInsertEKLF (Klf1 Mouse)
UseTagsFLAGExpressionMammalianMutationFull-length mEKLF is aa 20-376; amino acid 19 is …PromoterSV40Available sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T2 gp78 G2BR mt / JM26
Plasmid#13308DepositorInsertgp78 (AMFR Human)
UseTagsGSTExpressionBacterialMutationcDNA corresponds to aa309-643 derived from human …PromoterAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-gp78 Cue-m1,2 / JM22
Plasmid#13305DepositorInsertgp78 (AMFR Human)
UseTagsExpressionMammalianMutationM467G ; F468G ; P469R ; V476R ; D479V ; L480DPromoterAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable sinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-gp78 G2BR mt / JM23
Plasmid#13306DepositorInsertgp78 (AMFR Human)
UseTagsExpressionMammalianMutationQ579A ; R580A ; M581A ; L582G ; V583G ; Q584GPromoterAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-2xFLAG-2xSTREP-E2F2
Plasmid#236434Purposedoxycycline inducible expression of E2F2 in mammalian cellsDepositorInsertE2F2 (E2F2 Human)
UseTagsFLAG-FLAG-STREP-STREPExpressionMammalianMutationPromoterAvailable sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
NLS-Cherry-PCNA-P2A-Venus-E2F2
Plasmid#236447Purposeinsect expression of E2F2 for protein purificationDepositorInsertE2F2 (E2F2 Human)
UseTagsExpressionInsectMutationPromoterAvailable sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEP4 TAPBPR-TM-TN6
Plasmid#178650PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TM (E205K, R207E, Q209S, Q272S)DepositorInsertTAPBPR (TAPBPL Human)
UseTagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationE205K, R207E, Q209S, Q272S, switched transmembran…PromoterCMVAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…TagsExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only