We narrowed to 1,982 results for: rigi
-
Plasmid#84482PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [ChrimsonR-GFP]
Plasmid#108273PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Chronos-GFP]
Plasmid#84485PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α, 1.1 kb long (short version)Available SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY9
Plasmid#130907PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY59
Plasmid#130927PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::MCP controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
sfgfp
pspFΔHTH::MCP
UseSynthetic BiologyTagsASV tag and MCP (MS2 coat protein)ExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY57
Plasmid#130926PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA5B5 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA5B5, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY56
Plasmid#130925PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA4B4 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA4B4, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY55
Plasmid#130924PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA3B3, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY53
Plasmid#130911PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
GRP94-COMP-blac-flag-his
Plasmid#111008PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertendoplasmin, putative (GRP94) (PFL1070c Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAEBL-COMP-blac-flag-his
Plasmid#110963PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertmerozoite adhesive erythrocytic binding protein (MAEBL) (PF3D7_1147800.1 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAP50-COMP-blac-flag-his
Plasmid#110956PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted acid phosphatase (GAP50) (PF3D7_0918000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAP-COMP-blac-flag-his
Plasmid#111001PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertaminopeptidase P (APP) (PF14_0517 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
P47-COMP-blac-flag-his
Plasmid#111000PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein, putative (PSOP12) (PF3D7_0513700 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
SOAP-COMP-blac-flag-his
Plasmid#110997PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete adhesive protein (SOAP) (PF3D7_1404300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CTRP-COMP-blac-flag-his
Plasmid#110994PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertcircumsporozoite- and TRAP-related protein (CTRP) (CTRP Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
P25-COMP-blac-flag-his
Plasmid#110991PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertookinete surface protein P25 (PF10_0303 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only