We narrowed to 19,358 results for: comp
-
Plasmid#132533PurposeHuman Rbl-1, codon optimised for Sf9 expression.DepositorAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pVL94 - pOp4:VND7
Plasmid#116016Purposedestination vector for GreenGate cloning method, "Effector line", crossed with a "Driver line" the GOI, here VND7, will be expressed upon Dex-inductionDepositorInsertpOp4:B-dummy:VND7:VP16:tUBQ10::BastaR
ExpressionPlantAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-EKAR
Plasmid#181858PurposeGenetically encoded FRET-based sensor for monitoring ERK activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-EKAR
TagsmRuby2 and sfGFP(1-10)ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO HIS DNAJA4
Plasmid#19548DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
phumanCas9 (GB0575)
Plasmid#68206PurposeProvides the human codon optimized CDS of Cas9 protein as a level 0 GoldenBraid partDepositorInsertCas9 coding region (human codon optimised)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removed; human codon optimis…Available SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
vsv-CenpB 1-166-Sgo1 N61I-GFP
Plasmid#108499Purposeexpression of vsv-CenpB 1-166-Sgo1 N61I-EGFP (no PP2A binding)DepositorInsertCenpB-Shugoshin 1 (SGO1 Human)
TagsEGFP and VSVExpressionMammalianMutationCenpB 1-166 fusion before Sgo1, no PP2A binding N…PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
myc-hIFITM3-F63Q
Plasmid#104363PurposeExpresses human IFITM3-F63Q with an N-terminal myc tag in mammalian cells.DepositorInsertIFITM3 (IFITM3 Human)
TagsmycExpressionMammalianMutationmutated the following amino acid: F63QPromoterCMVAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PSTPIP1-1/1
Plasmid#91453PurposeProtein expression and purification of human SH3 domain construct PSTPIP1-1/1DepositorInsertPSTPIP1-1/1 (PSTPIP1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFL His-SDS22
Plasmid#113512PurposeExpression of His-SDS22 in insect cells (Baculovirus system)DepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only