We narrowed to 9,048 results for: sgRNA
-
Plasmid#128200PurposesgRNA backbone for StCas9, combine with TaU3 promoter module (pFH33)DepositorInsertsgRNA backbone for StCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-N-mCherryTag
Plasmid#218186PurposeTo tag Hevin with mCherry at the N-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMM725
Plasmid#68895PurposeIPTG-inducible CRISPRi vector targeting NanoLuc (NL3), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1
Plasmid#233078PurposeExpression vector for sgRNA-S1b and eCas12f1DepositorInsertU6-sgRNA-S1b (BsaI)-CBh-bpNLS-eCas12f1-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA3
Plasmid#164929PurposeExpresses Non-targeting sgRNA3 control in mammalian cellsDepositorInsertNon-targeting sgRNA3 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR GFP out of frame
Plasmid#155282PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with GFP, used with 155280DepositorInsertGFP out of frame IRES NGFR
Available SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 V2102I
Plasmid#139322PurposePlasmid expressing a sgRNA to introduce BRCA2 V2102I using base editingDepositorInsertsgRNA to insert BRCA2 V2102I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 E2772K
Plasmid#139323PurposePlasmid expressing a sgRNA to introduce BRCA2 E2772K using base editingDepositorInsertsgRNA to insert BRCA2 E2772K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJC.15A.sgRNA.TA
Plasmid#232483PurposesgRNA cloning backbone for expression of sgRNA in C. difficile. Contains TA system to enable maintenence without antibiotic selection.DepositorInsertsToxin-antitoxin System from CD630
medium-copy-number p15A origin of replication
mCherry
UseCRISPRExpressionBacterialPromoterP3 constitutive promoter and native promoterAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3015b
Plasmid#209317PurposeExpresses a sgRNA template with a protospacer cloning site flanked by BsaI restriction sites for easy insertion of a targeting cassette.DepositorInsertGroup B Streptococcus-compatible single guide RNA
ExpressionBacterialPromoterXyl/tet promoter that is constitutively activeAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper-T7IS1
Plasmid#140631PurposeExpresses ShCAST under the T7 promoter and an empty sgRNADepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA targeting IS1 (Escherichia coli)
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
PRINCE-SpCas9-2
Plasmid#250956PurposePRINCE drug inducible gene editing system based on SpCas9 (Lentiviral-Part II: the sgRNA expression is under drug-mediated control)DepositorInsertH1-TetO-SpCas9 sgRNA scaffold; EF1α-optTetR
UseCRISPR and LentiviralExpressionMammalianPromoterH1 promoter; EF1α promoterAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lentivirus ABE8e-V106W targeting PEX1-G843D
Plasmid#247667PurposeLentivirus genome encoding ABE8eV106W editor and Sp sgRNA cassette targeting PEX1-G843D mutationDepositorInsertABE8e-V106W editor and PEX1-G843D-targeting sgRNA
UseLentiviralExpressionMammalianPromoterEFSAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only