We narrowed to 13,309 results for: sequence

#72577

Bicistronic construct expressing PACSIN1 shRNA and HA-PACSIN1-rescue construct

Richard Huganir

Anggono et al Proc Natl Acad Sci U S A. 2013 Aug 20;11

May 10, 2017

Academic Institutions and Nonprofits only

#153432

Homology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SYFP2

Renee van Amerongen

de Man et al Elife. 2021 Jun 30;10. pii: 66440. doi:

Sept. 1, 2020

Academic Institutions and Nonprofits only

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#120296

AAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)

Dominik Niopek

Hoffmann et al Nucleic Acids Res. 2019 Apr 15. pii: 545

Jan. 25, 2019

Academic Institutions and Nonprofits only

#72049

Expresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 23, 2016

Academic Institutions and Nonprofits only

#67866

bacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. His tag

Walter Rossmanith

Vilardo et al Nucleic Acids Res. 2012 Dec;40(22):11583

Aug. 14, 2015

Academic Institutions and Nonprofits only

#132105

Gateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors

RESOLUTE Consortium, Giulio Superti-Furga

Polesel et al Biometals. 2022 Dec 1. doi: 10.1007/s105

Dec. 3, 2019

Industry, Academic Institutions, and Nonprofits

#71971

Expresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 25, 2016

Academic Institutions and Nonprofits only

#80056

Flk1/Kdrl promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequences

Tatjana Sauka-Spengler

Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi

Oct. 11, 2016

Academic Institutions and Nonprofits only

#71941

Expresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 25, 2016

Academic Institutions and Nonprofits only