We narrowed to 2,360 results for: mt
-
Plasmid#128511PurposeLentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag.DepositorInsertNENF (NENF Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSynonymous silent mutations to F81, Y82, G83 and …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-TP53-1
Plasmid#121917PurposeEncodes sgRNA targeting exon 4 of TP53DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIH-mRuby2-BAX
Plasmid#111628PurposeFluorescent fusion protein used to visualise mouse BAX, with hygromycin selectionDepositorAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-EGFP-WPRE
Plasmid#51504PurposeCan be used to generate AAV virus that will express EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertEGFP
UseAAVPromoterphSyn1Available SinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-TP53-2
Plasmid#121918PurposeEncodes sgRNA targeting exon 9 of TP53DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIH-mRuby2-BAK
Plasmid#111627PurposeFluorescent fusion protein used to visualise mouse BAK, with hygromycin selectionDepositorAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
IMPT-6213
Plasmid#99333PurposeAT2R N terminal BRIL, linker GSGS, delta aa 1-34, delta aa 336-363DepositorAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-WT
Plasmid#128508PurposeLentiviral constitutive expression of C20orf24 under control of its native WT 3'UTR of human C20orf24.DepositorAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac CAG eGFP-PolQ10A-FLAG P2A-BLAST
Plasmid#249812PurposeExpresses the polymerase theta protein fused with N-terminal eGFP and C-terminal FLAG tag and mutated at serines 1289, 1482, 1486, 1488, 1493, 1555, 1563, 1628, 1635 and threonine 1755 into alaninesDepositorInsertPolymerase Theta (POLQ Human)
TagsFLAG and eGFPExpressionMammalianMutationserines 1289, 1482, 1486, 1488, 1493, 1555, 1563,…PromoterCAGAvailable SinceMarch 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R82A_pET-14b
Plasmid#233276PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 82 was substituted with alanine (R82A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 82…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R64A_pET-14b
Plasmid#233263PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 64 was substituted with alanine (R64A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 64…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7V51G-VA
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7H126A-VA
Plasmid#115185PurposeLentiviral transduction and expression of PARK7H126A into any mammalian cellDepositorInsertPARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.H126APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7E163K-VA
Plasmid#115186PurposeLentiviral transduction and expression of PARK7E163K into any mammalian cellDepositorInsertPARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.E163KPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only