-
Plasmid#61529PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIP (with TD mutation)DepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TD mutation (see comments) and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP (TE)
Plasmid#61530PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIP (with TE mutation)DepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TE mutation (see comments) and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat DJ-1 shRNA
Plasmid#222870PurposeExpresses mTagBFP2 along with an shRNA against rat DJ-1DepositorInsertDJ-1 shRNA (Park7 Rat)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available sinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-CD52-bglpA
Plasmid#89704PurposeHuman CD52 expression plasmid with short polyADepositorInsertCMV-CD52-bglpA (CD52 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
YF-AIP
Plasmid#61525PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with EYFP and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP and EYFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
CF-AIP
Plasmid#61526PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with ECFP and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP and ECFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-imp α
Plasmid#119718PurposeExpresses EGFP-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
UseTagsEGFPExpressionMammalianMutationcontains amino acids 251-529PromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Mm2
Plasmid#197100PurposeTo express the variant of Methanosarcina mazei PylRS specific for pyrrolysine derivatives (Boc-Lys, Az-ZLys, AzAmZLys) and its cognate Pyl tRNA and allow UAG codon to be translated into these derivatiDepositorInsertPylRS variant, Pyl tRNA, kanamycin resistance gene
UseTagsExpressionBacterialMutationLys61, Glu131, Ala306, Phe384, Glu444 (PylRS)PromoterAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro
Plasmid#89991PurposeDonor template for generation of SOX2-ntdTomato reporter cell linesDepositorInsertSOX2-T2A-2xNLS-TdTomato-F2A-Puro (SOX2 Human)
UseCRISPRTagsExpressionMutationPromoternoneAvailable sinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TA)
Plasmid#61513PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TA mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP with TA mutation (see comments), Tom20, and m…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP
Plasmid#61512PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIPDepositorInsertFK506 binding protein 1A (FKBP1A Human)
UseTagsAIP, Tom20, and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-mCherry-LOV2(wt)
Plasmid#107693PurposeN-terminal half of π-EB1 with wild-type LOV2, mCherry-tagged to track microtubule endsDepositorInsertMAPRE1 (MAPRE1 Human)
UseTagsA. sativa phototropin 1 LOV2 domain, GCN4 leucine…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(fast)
Plasmid#107690PurposeN-terminal half of π-EB1 with fast LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
UseTagsA. sativa phototropin 1 LOV2 domain (I427V, H519L…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-mScarlet
Plasmid#139503PurposeExpresses mScarlet-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
UseTagsmScarlet following Gly-Gly-Ser linkerExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF17*-strep
Plasmid#120167PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF17-based anterograde motor and streptavidinDepositorInsertkinesin family member 17 (KIF17 Human)
UseTagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF17: 1-509 aaPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF13A*-strep
Plasmid#120166PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF13A-based anterograde motor and streptavidinDepositorInsertkinesin family member 13A (KIF13A Human)
UseTagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF13A: 1-639 aaPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF5A*-strep
Plasmid#120163PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF5A-based anterograde motor and streptavidinDepositorInsertkinesin family member 5A (Kif5a Mouse)
UseTagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF5A: 1-559 aaPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAFNF-PSDd1.2-GFP
Plasmid#125581PurposeFlp-dependent expression of PSD d1.2-GFP (a deletion mutant of PSD-95 fused to GFP) in mammalian cells.DepositorInsertPSDd1.2-GFP (Dlg4 Mouse)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only