Skip to main content

We narrowed to 28 results for: αGFP

Showing: 1 - 20 of 28 results
  1. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ...the limitations is the size of GFP: ~240 amino acids or about 28 kDa. GFP and its homologues have a beta-barrel...and shape matters The green fluorescent protein (GFP) from Aequorea victoria and its variants are genetically...interference is known as steric hindrance. For instance, GFP may occlude catalytic sites or obstruct binding sites...post-translational modifications. Despite these potential issues, GFP has been used successfully in countless fusion proteins... an inert light emitting module, any tendency of GFP to homodimerize should be avoided because it will...the linker sequence short In the early days of GFP applications, many were concerned with steric hindrance...fluorescent proteins derived from Aequorea victoria GFP sticks out and can be considered a linker (figure...
  2. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...al. observed some GFP aggregation, which they reduced by using superfolder GFP (sfGFP) with the small solubility...scaffold fully occupied with GFP has a molecular weight of 1,400 kDa vs 24 kDa for GFP alone. Although traditional...nomenclature throughout the rest of this blog post, GFP refers to sfGFP-GB1.   Tanenbaum et al. examined the power... copies of the short epitope GCN4. GCN4 recruits GFP fused to the cognate scFV antibody, which is expressed...physiology. Having seen that mitochondrial tracker GFP-mitoNEET can impair mitochondrial function, they ...they examined the effects of mitoNEET-SunTag-GFP. As expected, they obtained bright images of mitochondria... al. modified the GCN4 sequence to increase its alpha-helical structure and stability, creating v4 SunTag...
  3. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...Chang-Deng Hu Green sfGFP Split super-folder GFP, our most-requested GFP(1–10) and GFP(11) Versatile protein...Commun. 2016 Bo Huang spGFP Split superpositive GFP Split-superpositive GFP reassembly is a fast, efficient...base FP (for example, EBFP2(1–10) can be used with GFP(11)). Some of the articles linked below only provide... EBFP2 EBFP2(1–10) and Capri(1–10) for use with GFP(11) Multiplexed labeling of cellular proteins with...Kamiyama Cerulean Cerulean(1–10) for use with GFP(11) Multiplexed labeling of cellular proteins with... high-throughput screen for molecules affecting alpha-synuclein oligomerisation. Eastwood et al. FEBS ...background signal (especially for some older split-GFP constructs or certain cell environments). Also consider...
  4. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21217 ...Microtubules alpha-Tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-Tubulin...Beta-catenin GFP Adherens junctions beta-Catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...61803 GFP-Rab7A Endosomes (late) Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Endosomes (late) RAB7 GFP Richard...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin filaments alpha-Actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1... Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal adhesions alpha-Actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Microtubules alpha-Tubulin mTurquoise2 Dorus Gadella 85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-Tubulin...
  5. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...S65T) in the original jellyfish GFP (AvGFP) to create enhanced GFP (EGFP), a variant with improved brightness... There are numerous GFP variants. Here I use the name ‘GFP’, which refers to mEGFP. This variant was made...examined on a case-by-case basis. GFP is sensitive to acid The chromophore of GFP can exist in a protonated and...its acid tolerance is maintained in cells.   GFP is big GFP is a 28 kDa protein that resembles a cylinder...2013; Hilaire et al., 2017). GFP can only be used for tagging proteins GFP fusion proteins are made by ... a fusion with GFP allows for detection of genomic locations (Chen et al., 2013). GFP fluorescence overlaps... al., 2018). GFP is not tolerated in my fusion It is standard practice to attach the GFP to the N- or ...
  6. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  7. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...., 2023. nLight nLight sensors are based on alpha-1a adrenergic receptor; nLightG contains circularly...circularly permuted green fluorescent protein (GFP), and nLightR uses a red fluorescent protein, mApple. Kagiampaki...blocked by alpha2-AR antagonist, nLight sensors are not. Instead, they are blocked by alpha1-AR antagonist...antagonist. This is important because alpha2-AR can provide inhibitory feedback in response to norepinephrine...multiplexing in experiments, including ones that study alpha2-AR. Selectivity Norepinephrine and dopamine are...
  8. Understanding GPCR Signaling Using TRUPATH

    Type
    Blog Post
    ...complex consists of a trimer of three subunits: alpha, beta, and gamma (Gα, Gβ, and Gγ), collectively ...transfer 2, or BRET2. With binding of the drug, the alpha and beta subunits dissociate resulting in decreased... acceptor GFP2-Gγ chimeras, and two untagged Gβ constructs. For the Gγ constructs, the GFP2 tag is fused... Gα-Rluc8 and Gγ-GFP2 will be in close association, resulting in a high level of GFP2 emission. Following...interest, a Gα-Rluc8 plasmid, and the appropriate Gγ-GFP2 and Gβ constructs. Cells are then treated with the...complex will disassociate, resulting in a decreased GFP2 emission. The activation state can be measured by... by a BRET2 ratio, which is the ratio of GFP2 emission to RLuc8 emission (see figure). What can TRUPATH...
  9. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...bundle; SAH: 60-nm single alpha helix) and target capture module (SpyTag-GFP nanobody) assembled on beads...In MagIC-cryo-EM, target proteins (expressed as a GFP fusion in this proof-of-concept study) are captured...SpyTag-SpyCatcher linkers and spacer proteins ending with a GFP nanobody (Figure 1). This enrichment streamlines ...beads. C) Micrograph of H1.8-GFP nucleosomes collected with MagIC-cryo-EM. Nucleosome-like particles identified...) 3D model of the obtained structure of the H1.8-GFP-bound nucleosome. Images adapted from Arimura et ...
  10. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...
  11. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...respectively of a GFP dependent Cre. The two segments come together in the presence of GFP to form a functional... activation to cells expressing both Cre and GFP. The GFP dependent FLPo, Flp-DOG (75469), is also available...-2 proteins ChR2 for targeted expression DREADDs GFP dependent Cre and FLPo And more!  New lentiviral...in new serotypes, as well as a new Cre dependent GFP control plasmid for expression in forebrain GABA-...Karl Deisseroth 83895 AAVrg pAAV-hDlx-Flex-GFP-Fishell_6 Gordon Fishell   Optogenetics Optogenetics...transgenic reporter lines that supply a variety of GFP expression patterns, thus allowing you to further...AAV2 pAAV-Ef1a-fDIO mCherry 83900 AAVrg pAAV-mDlx-GFP-Fishell-1 Biosensors Plasmid Serotype Name ...
  12. Lentivirus Plasmids

    Type
    Collection
    ...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin... Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter...reporter. See plasmid 17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination...Stephen Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can ...
  13. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin ...AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1...AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...
  14. Sequencing Primers

    Type
    Guide
    ...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward...CCATCTAATTCAACAAGAATTGGGACAAC 5' end of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW... Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter Forward Xpress Forward TATGGCTAGCATGACTGGT...early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse...
  15. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome ...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A     ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...
  16. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...Mouse 199429 GFP scFv [N86/8] N86/8 scFv GFP Aequorea victoria Mouse 199430 GABA(A)R, Alpha1 scFv [N95/35...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-...
  17. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR...methylation in mammalian cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced...Goodell's lab has deposited pcDNA3.1-dCas9-MQ1(Q147L)-EGFP, a fusion of dCas9 to a small DNA methyltransferase...epigenome-editing tools. pLV hUbC-dCas9-MQ1(Q147L)-EGFP is also available for lentiviral transduction. Lysine-specific...
  18. Neurodegeneration Research Collection

    Type
    Collection
    ...Express EGFP-tagged wt and mt tau . (Hoover et al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein... Use the 3xFlag-eGFP-Flag-SETX construct for subcellular localization studies with GFP, or IP with Flag...lentiviral expression constructs: pLVX-UbC-rtTA-Ngn2:2A:EGFP (Schafer et al. Nat Neurosci. 2019) pLVX-UbC-rtTA-Ngn2...
Showing: 1 - 20 of 28 results