Skip to main content
Addgene

We narrowed to 81 results for: USP

Showing: 1 - 20 of 81 results
  1. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...extraction solution per well and resuspend. Continue to step 7.3 for suspension cells. For adherent cells, ...CRISPR Cloning Anneal and phosphorylate oligos. Resuspend oligos at a concentration of 100 μM in ddH 2 O...detail for murine erythroleukemia (MEL) cells, a suspension cell line. The culture medium in all steps consists...strategies for each cell type. While MEL cells are suspension cells, instructions for adherent cells have ...Ensure there are 2 x 10 6 cells per CRISPR pair. Resuspend 2 x 10 6 cells in 100 μl of electroporation solution...validation (see step 6 ). NOTE: This protocol is for suspension cells. Adherent cells can either grow as individual... gDNA from parental and bulk sorted cells by resuspending parental and bulk cell pellets in 50 μl of DNA...
  2. Ras Pathway

    Type
    Collection
    ...suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity phosphatase E2F...
  3. AAV Vector Quality Control: Going the Extra Mile with NGS

    Type
    Blog Post
    ...hits to the CHRM4 gene. When contamination is suspected, we proceed to de novo assembly of the unmapped...aligned to plasmids in our inventory containing the suspected contaminating sequence. In most cases, the source...identified, and we will discard any AAV prep we suspect is contaminated. For AAV-68544, the best match ...
  4. Antibodies 101: Producing Recombinant Antibodies

    Type
    Blog Post
    ...this method, beads are incubated with the cell suspension. Antibodies bind ligands on the beads and a magnet...Grazzini E, Durocher Y. Transient Gene Expression in Suspension HEK293-EBNA1 Cells. Methods Mol Biol. 2018;1850...on magnetic beads from very high cell density suspension. Biotechnol Bioeng. 2021 Sep;118(9):3499-3510...
  5. What the HEK?

    Type
    Blog Post
    ...though derivatives have been adapted for growth in suspension. Of the many derivatives of HEK-293, the most...systems, such as yeast. HEKs can also grow in suspension, which allows for large scalability, and can ...
  6. RNA Extraction Without A Kit

    Type
    Blog Post
    ...least 4 hours.   If your final RNA sample(s) are resuspended in water or TE buffer, store them in a -80°C ...products on the market to choose from) on your resuspended RNA sample will help ensure DNA contamination...
  7. Supporting Rare Disease Research with the 2020 BeHEARD Awards

    Type
    Blog Post
    ...chromosomes is partially or completely missing in women. Bicuspid aortic valve (an aortic valve that has two leaflets...study is to understand why women with TS develop bicuspid aortic valve at a rate that is 50-100 times higher...
  8. 5 Tips for Troubleshooting Viral Transductions

    Type
    Blog Post
    ...ultracentrifugation of the viral stock, followed by resuspension of the collected particles in a smaller volume...white pellet. The pellet can then be rinsed and resuspended in cold sterile PBS.  Alternatively, to concentrate...
  9. Hot Plasmids and Viral Preps - May 2021

    Type
    Blog Post
    ..., homogeneous time resolved fluorescence, and suspension bead assay (Figure 2). After finding no cross-reactivity...scFVs to cognate aaRS antigens as measured by suspension bead assay. Image from  Preger et al., 2020. ...
  10. Tips for arabidopsis transformation

    Type
    Blog Post
    ...agrobacterial cultures are ready, spin them down and resuspend them in transformation media. If you are dipping...transformant. I like to spin down 100 mL of culture and resuspend in 25 mL of transformation medium per Agrobacterium...
  11. Plasmids 101: Colony PCR

    Type
    Blog Post
    ...day, you can save the leftover bacteria-water suspension and use them to start cultures of your positive...up PCR reactions: The remaining bacteria-water suspension will serve as the template for your PCR reaction...
  12. The Challenges of Cell Culture

    Type
    Blog Post
    ...technique (aka DNA fingerprinting) that can place suspects at the scene of a crime (every human in the world...passaged your current batch too many times or you suspect there is contamination. You would never thaw any...
  13. Validated gRNA Sequences

    Type
    Collection
    ...GAGTAAAAAATTGTACTTGG 64330 cut S. pyogenes 25281382 Jin USP13 H. sapiens GCCGCCCGGCATGCCGAACA 61812 cut S. pyogenes...
  14. 10 Steps to a Perfect Science Talk

    Type
    Blog Post
    ... below “Tell a story”) and note how they build suspense. Notice the simplicity of their slides and how..., you just need to figure out how to make it suspenseful. 4. Start preparing your talk early - like today...
  15. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...system An electronics system  Cells are first resuspended in a pressurized buffer called sheath fluid and...instrument clogs, ensure that samples are single cell suspensions. For cells that tend to aggregate, pass the sample...
  16. Antibody Guide

    Type
    Collection
    ...the growth medium and can either be used while suspended in the original media or isolated and placed in...
  17. Countdown to Halloween @Addgene

    Type
    Blog Post
    ...archives I found pictures back through 2009, though I suspect that our costume contests were indeed occurring...
Showing: 1 - 20 of 81 results