We narrowed to 5 results for: USP
-
TypeCollection...extraction solution per well and resuspend. Continue to step 7.3 for suspension cells. For adherent cells, ...CRISPR Cloning Anneal and phosphorylate oligos. Resuspend oligos at a concentration of 100 μM in ddH 2 O...detail for murine erythroleukemia (MEL) cells, a suspension cell line. The culture medium in all steps consists...strategies for each cell type. While MEL cells are suspension cells, instructions for adherent cells have ...Ensure there are 2 x 10 6 cells per CRISPR pair. Resuspend 2 x 10 6 cells in 100 μl of electroporation solution...validation (see step 6 ). NOTE: This protocol is for suspension cells. Adherent cells can either grow as individual... gDNA from parental and bulk sorted cells by resuspending parental and bulk cell pellets in 50 μl of DNA...
-
Ras Pathway
TypeCollection...suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity phosphatase E2F... -
Validated gRNA Sequences
TypeCollection...GAGTAAAAAATTGTACTTGG 64330 cut S. pyogenes 25281382 Jin USP13 H. sapiens GCCGCCCGGCATGCCGAACA 61812 cut S. pyogenes... -
Antibody Guide
TypeCollection...the growth medium and can either be used while suspended in the original media or isolated and placed in... -
Trimmer Lab NeuroMab Collection
TypeCollection...protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids ...