We narrowed to 81 results for: USP
-
TypeCollection...extraction solution per well and resuspend. Continue to step 7.3 for suspension cells. For adherent cells, ...CRISPR Cloning Anneal and phosphorylate oligos. Resuspend oligos at a concentration of 100 μM in ddH 2 O...detail for murine erythroleukemia (MEL) cells, a suspension cell line. The culture medium in all steps consists...strategies for each cell type. While MEL cells are suspension cells, instructions for adherent cells have ...Ensure there are 2 x 10 6 cells per CRISPR pair. Resuspend 2 x 10 6 cells in 100 μl of electroporation solution...validation (see step 6 ). NOTE: This protocol is for suspension cells. Adherent cells can either grow as individual... gDNA from parental and bulk sorted cells by resuspending parental and bulk cell pellets in 50 μl of DNA...
-
Ras Pathway
TypeCollection...suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity phosphatase E2F... -
AAV Vector Quality Control: Going the Extra Mile with NGS
TypeBlog Post...hits to the CHRM4 gene. When contamination is suspected, we proceed to de novo assembly of the unmapped...aligned to plasmids in our inventory containing the suspected contaminating sequence. In most cases, the source...identified, and we will discard any AAV prep we suspect is contaminated. For AAV-68544, the best match ... -
Antibodies 101: Producing Recombinant Antibodies
TypeBlog Post...this method, beads are incubated with the cell suspension. Antibodies bind ligands on the beads and a magnet...Grazzini E, Durocher Y. Transient Gene Expression in Suspension HEK293-EBNA1 Cells. Methods Mol Biol. 2018;1850...on magnetic beads from very high cell density suspension. Biotechnol Bioeng. 2021 Sep;118(9):3499-3510... -
What the HEK?
TypeBlog Post...though derivatives have been adapted for growth in suspension. Of the many derivatives of HEK-293, the most...systems, such as yeast. HEKs can also grow in suspension, which allows for large scalability, and can ... -
Supporting Rare Disease Research with the 2020 BeHEARD Awards
TypeBlog Post...chromosomes is partially or completely missing in women. Bicuspid aortic valve (an aortic valve that has two leaflets...study is to understand why women with TS develop bicuspid aortic valve at a rate that is 50-100 times higher... -
RNA Extraction Without A Kit
TypeBlog Post...least 4 hours. If your final RNA sample(s) are resuspended in water or TE buffer, store them in a -80°C ...products on the market to choose from) on your resuspended RNA sample will help ensure DNA contamination... -
5 Tips for Troubleshooting Viral Transductions
TypeBlog Post...ultracentrifugation of the viral stock, followed by resuspension of the collected particles in a smaller volume...white pellet. The pellet can then be rinsed and resuspended in cold sterile PBS. Alternatively, to concentrate... -
Hot Plasmids and Viral Preps - May 2021
TypeBlog Post..., homogeneous time resolved fluorescence, and suspension bead assay (Figure 2). After finding no cross-reactivity...scFVs to cognate aaRS antigens as measured by suspension bead assay. Image from Preger et al., 2020. ... -
Tips for arabidopsis transformation
TypeBlog Post...agrobacterial cultures are ready, spin them down and resuspend them in transformation media. If you are dipping...transformant. I like to spin down 100 mL of culture and resuspend in 25 mL of transformation medium per Agrobacterium... -
Plasmids 101: Colony PCR
TypeBlog Post...day, you can save the leftover bacteria-water suspension and use them to start cultures of your positive...up PCR reactions: The remaining bacteria-water suspension will serve as the template for your PCR reaction... -
The Challenges of Cell Culture
TypeBlog Post...technique (aka DNA fingerprinting) that can place suspects at the scene of a crime (every human in the world...passaged your current batch too many times or you suspect there is contamination. You would never thaw any... -
Validated gRNA Sequences
TypeCollection...GAGTAAAAAATTGTACTTGG 64330 cut S. pyogenes 25281382 Jin USP13 H. sapiens GCCGCCCGGCATGCCGAACA 61812 cut S. pyogenes... -
10 Steps to a Perfect Science Talk
TypeBlog Post... below “Tell a story”) and note how they build suspense. Notice the simplicity of their slides and how..., you just need to figure out how to make it suspenseful. 4. Start preparing your talk early - like today... -
Antibodies 101: Flow Cytometry
TypeBlog Post...system An electronics system Cells are first resuspended in a pressurized buffer called sheath fluid and...instrument clogs, ensure that samples are single cell suspensions. For cells that tend to aggregate, pass the sample... -
Antibody Guide
TypeCollection...the growth medium and can either be used while suspended in the original media or isolated and placed in... -
Streaking for Single Colonies: The Streak Plate Challenge
TypeBlog Post...challenging, potentially by using a thicker bacterial suspension,” says Westenberg. In addition to streaking for... -
Countdown to Halloween @Addgene
TypeBlog Post...archives I found pictures back through 2009, though I suspect that our costume contests were indeed occurring... -
6 Tips for Analyzing and Troubleshooting Sanger Sequencing Results
TypeBlog Post...reliable DNA sequence Anything less and you might suspect contamination in your sample or consider asking... -
Save Time and Money by Making Your Own Competent Cells
TypeBlog Post...our E. coli in LB to log phase, then wash and resuspend the cells in the provided buffers. The competent...