Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 89 results
  1. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ... review articles (2–4). You can also take a look at my recent paper to see the Gal4/UAS system in action...118, 401–15 (1993). PubMed PMID: 8223268. 2. J. B. Duffy, GAL4 System in Drosophila : A Fly Geneticist’...-type specificity! The Gal4/UAS system At a more detailed level, the Gal4/UAS system is a transcription...the UAS sequence are only expressed when Gal4 is expressed. Gal4 expression can be regulated by any chosen...Controlling multiple genes with Gal4/UAS system One can also use Gal4 to drive expression of multiple ...Applications of the Gal4/UAS system There are a number of fancy ways to use the Gal4/UAS system, and you...down. To do this, Drosophila geneticists use the Gal4/UAS system. This incredibly useful, yet simple system...
  2. Plasmids 101: E. coli Strains for Protein Expression

    Type
    Blog Post
    ...fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) General...containing T7 RNAP (DE3) F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) General protein expression BL21 (DE3...origin of replication F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) pLysS (CamR) Expression of toxic proteins...origin of replication F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) pLysE (CamR) Expression of toxic proteins...transcript half-life F- ompT lon hsdSB (rB- mB-) gal dcm rne131 (DE3) General expression; not recommended...required for expression F- ompT lon hsdSB (rB- mB-) gal dcm araB::T7RNAP-tetA General protein expression...repetative sequences.  F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) Δ(srl-recA)306::Tn10 (TetR) Expression...
  3. Adenovirus Plasmids

    Type
    Collection
    ...Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for use...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...TARDBP GAL ALS Aaron Gitler 27465 pDuet TDP-43 Q331K TARDBP GAL ALS Aaron Gitler 27466 pRS426 Gal TDP43...TDP43 TARDBP GAL ALS Aaron Gitler 27467 pRS426 Gal TDP43 GFP TARDBP GFP GAL ALS Aaron Gitler 27468 pRS303...1185 p416 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1186 p416 103Q GAL HTT GFP GAL1 Huntington's...1187 p426 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1188 p426 103Q GAL HTT GFP GAL1 Huntington's...27458 pRS416 Gal TDP43 WT TARDBP GAL1 ALS Aaron Gitler 27459 pRS416 Gal TDP43 G294A TARDBP GAL1 ALS Aaron... pRS416 Gal TDP43 M337V TARDBP GAL1 ALS Aaron Gitler 27461 pRS416 Gal TDP43 Q331K TARDBP GAL1 ALS Aaron...pAG416-Gal-PR50 C9orf72 FLAG, Myc GAL1 ALS Aaron Gitler 84902 pAG416-Gal-PA50 C9orf72 FLAG, Myc GAL1 ALS ...
  5. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...featuring a guest blog post from Gal Haimovich of greenfluorescentblog. Gal will share his list of 10 things...experiments. In the meantime, if you haven't checked out Gal's blog, you should! He's got great articles and insight...from GFP and the mutation definitions found in Table 2 may not apply. Table 1: The specific mutations comprising..., V163A EBFP F64L, S65T, Y66H, Y145F   Table 2: Functional role of specific mutations in GFP derivatives...
  6. Plasmids 101: Screening Strategies Used in Plasmid Cloning

    Type
    Blog Post
    ...researcher, when the substrate X-gal is broken down by 𝛽-galactosidase, it turns into an insoluble blue...disrupting 𝛽-galactosidase activity. These cells, presumably the cell you want, cannot break down X-gal and are...transformation on ampicillin plates containing X-gal allows you to identify cells that took up the vector...about colony PCR in this blog post.   Figure 2: The steps of colony PCR.   Sanger sequencing Sanger...on the lacZ gene. lacZ encodes the enzyme 𝛽-galactosidase which can hydrolyse lactose. Fortunately, for... is deleted, it creates a non-functional 𝛽-galactosidase. Complementing this mutation by expressing this...example on a plasmid, creates a functional 𝛽-galactosidase. Blue-white screens rely on vectors where the...
  7. Open Resources and Plasmid Tools For Studying C. elegans

    Type
    Blog Post
    ...  Plasmids for cGAL and split cGAL systems The Sternberg lab in 2016 created cGAL, a GAL-4 based bipartite...MicroPublication 1 (2018): 2–3. Wang, Han, et al. "cGAL, a temperature-robust GAL4–UAS system for Caenorhabditis...this system a promoter controls the expression of a GAL-4 driver that can bind to activation sequences upstream...2018, the lab expanded on this tool by splitting cGAL4 in two and binding each half to a gp41-1-N-intein...split system, only cells that have both halves of cGAL can drive expression of your gene of interest.  ...Central PMCID: PMC5693259.  Wang, Han, et al. "Split cGAL, an intersectional strategy using a split intein...
  8. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...Table 2: Lab strains of E. coli Strain Natural resistance Primary Use Genotype ccdB Survival 2 T1R ...resistance gal Mutation in galactose metabolism pathway Cells cannot grow on galactose only gyrA, .... F' mcrA Δ(mcrBC-hsdRMS-mrr) recA1 endA1 gyrA96 gal-thi-1 supE44 λ-relA1 Δ(lac-proAB)/F' proAB+lacIqZΔM15...resistance to tetracycline Additionally, Table 2 provides a quick reference for some of the popular...Φ80lacZΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG fhuA::IS2 DB3.1 Streptomycin...screening, leucine auxotroph. F- endA1 recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,...plasmid after preparation. rpsL thr leu thi lacY galK galT ara tonA tsx dam dcm glnV44 Δ(lac-proAB) e14- ...
  9. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ...This post was contributed by Gal Haimovich of greenfluorescentblog. Be honest. Do you really know how...greenfluorescentblog. Thank You to Our Guest Blogger! Gal Haimovich, PhD, is a research fellow in the lab of...system (by measuring the fluorescence intensity); and 2) to visualize the localization of the FP (fused to...
  10. Golden Gate Assembly Upgrades: More Fragments, Faster Assembly, and Higher Fidelity

    Type
    Blog Post
    ... a blue colony phenotype upon growth on LB/Cam/X-gal/IPTG agar plates, indicating successful reconstruction...Golden Gate Assembly is commonly used to assemble 2–10 DNA fragments in a single “one-pot” reaction to...the transformants onto the selection plate. Figure 2 shows representative transformation plates obtained...fidelity studies conducted by Potapov et al. at NEB (1, 2). While T4 DNA Ligase, the mainstay of most biotechnological... (percent correct) Calculated colony totals Per 2 μl assembly reaction Per full assembly reaction** ...calculated yields from entire outgrowth built from 2 µl of the assembly reaction, and from the entire assembly...fidelity and bias profiling." bioRxiv (2018): 322297. 2. Potapov, Vladimir, et al. "A single-molecule sequencing...
  11. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ... et al. transduced rat neurons in vivo with beta-gal and other reporters, and they showed that expression...create the 2nd-generation lentiviral system (Figure 2). The HIV genes that do remain are very important ...1996 Apr 12;272(5259):263-7. PubMed PMID: 8602510. 2. A third-generation lentivirus vector with a conditional...CH, Humeau LM, Rebello T. J Gene Med. 2013 Feb;15(2):78-82. PubMed PMID: 23322669. 6. Genetic treatment... Banasik MB, McCray PB Jr. Gene Ther. 2010 Feb;17(2):150-7. PubMed PMID: 19847206. Additional Resources...cells by a lentiviral vector. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, Trono ... Cartier N, Aubourg P, Fischer A, Cornetta K, Galacteros F, Beuzard Y, Gluckman E, Bushman F, Hacein-Bey-Abina...
  12. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...ODG1 GAL galanin prepropeptide GALN, GLNN, GMAP, MGC40167 GALP galanin-like peptide - GALR2 galanin receptor...
  13. Qi Lab CRISPR Page

    Type
    Collection
    ...could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi system for mammalian gene knockdown...of both plasmids in HEK293 cells could cause up to 2~3-fold repress on targeted fluorescent genes. These...promoter and sgRNA targeting GFP (NT1) 46917 pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine U6 promoter... promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector containing murine U6 promoter... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...
  14. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens...GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA...26355004 Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...
  15. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks...101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP... AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA polymerase...mEGFP AICSDP-77 mEGFP Telomeric repeat-binding factor 2 (TRF2) Telomeres 168799 CTCF-mEGFP AICSDP-144 mEGFP...28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi...
  16. Zhang Lab CRISPR Page

    Type
    Collection
    ...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014...
  17. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...safely. Recently, many SARS-CoV-2 researchers began pseudotyping the SARS-CoV-2 spike protein into a lower ...SARS-CoV-2 virus. Scientists have been using similar pseudotyping methods with other viruses in a BSL-2 lab... et a., 2018).   Figure 2: To pseudotype with the SARS-CoV-2 spike protein, scientists encode..., HIV-2, and human foamy virus in cell lines expressing galactosyl(alpha1-3)galactosyl (alphaGal) sugars...production uses three plasmids: (1) The transfer plasmid, (2) the envelope plasmid, and (3) the packaging plasmid...for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays. Viruses 12...Are Inactivated by Human Serum. Molecular Therapy 2:218–222 . https://doi.org/10.1006/mthe.2000.0116 Gutierrez-Guerrero...
  18. Antibody Neutralization Response Against Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants

    Type
    Blog Post
    ...-YS, Lessells RJ, de Oliveira T, Sigal A (2021) Escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent...Poznansky MC, Sigal A, Schmidt AG, Iafrate AJ, Naranbhai V, Balazs AB (2021) Multiple SARS-CoV-2 variants ...months, we’ve seen the emergence of several SARS-CoV-2 variants coincide with increased vaccination efforts...They were able to tweak this assay to study SARS-CoV-2 spike variants. “We created a series of spike expressing...relative ability to neutralize.”   Figure 2: Sera used in the study came from individuals who ...This sera was used in the high-throughput SARS-CoV-2 pseudovirus neutralization assay. Neutralization was...viruses are quite genetically distinct from SARS-CoV-2 and its variants. Yet, the B.1.351 variant, which ...
  19. Distribution to Industry

    Type
    Collection
    ...Information Featured Collections COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from ... transfers to for-profit entities. The MTA is a legal agreement between the recipient and the depositing...authorized signatory is someone who can execute legal documents on behalf of the recipient institution...
Showing: 1 - 20 of 89 results