Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 17 of 17 results

  1. Adenovirus Plasmids

    Type
    Collection
    ...Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...recombining shuttle plasmids Vogelstein 16401 pAdEasy-2 Adenoviral For recombining shuttle plasmids; for use...

  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...TARDBP GAL ALS Aaron Gitler 27465 pDuet TDP-43 Q331K TARDBP GAL ALS Aaron Gitler 27466 pRS426 Gal TDP43...TDP43 TARDBP GAL ALS Aaron Gitler 27467 pRS426 Gal TDP43 GFP TARDBP GFP GAL ALS Aaron Gitler 27468 pRS303...1185 p416 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1186 p416 103Q GAL HTT GFP GAL1 Huntington's...1187 p426 25Q GAL HTT GFP GAL1 Huntington's Susan Lindquist 1188 p426 103Q GAL HTT GFP GAL1 Huntington's...27458 pRS416 Gal TDP43 WT TARDBP GAL1 ALS Aaron Gitler 27459 pRS416 Gal TDP43 G294A TARDBP GAL1 ALS Aaron... pRS416 Gal TDP43 M337V TARDBP GAL1 ALS Aaron Gitler 27461 pRS416 Gal TDP43 Q331K TARDBP GAL1 ALS Aaron...pAG416-Gal-PR50 C9orf72 FLAG, Myc GAL1 ALS Aaron Gitler 84902 pAG416-Gal-PA50 C9orf72 FLAG, Myc GAL1 ALS ...

  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...ODG1 GAL galanin prepropeptide GALN, GLNN, GMAP, MGC40167 GALP galanin-like peptide - GALR2 galanin receptor...

  4. Qi Lab CRISPR Page

    Type
    Collection
    ...could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi system for mammalian gene knockdown...of both plasmids in HEK293 cells could cause up to 2~3-fold repress on targeted fluorescent genes. These...promoter and sgRNA targeting GFP (NT1) 46917 pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine U6 promoter... promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector containing murine U6 promoter... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...

  5. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens...GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA...26355004 Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...

  6. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks...101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP... AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA polymerase...mEGFP AICSDP-77 mEGFP Telomeric repeat-binding factor 2 (TRF2) Telomeres 168799 CTCF-mEGFP AICSDP-144 mEGFP...28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi...

  7. Zhang Lab CRISPR Page

    Type
    Collection
    ...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014...

  8. Distribution to Industry

    Type
    Collection
    ...Information Featured Collections COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from ... transfers to for-profit entities. The MTA is a legal agreement between the recipient and the depositing...authorized signatory is someone who can execute legal documents on behalf of the recipient institution...

  9. Cre-lox system

    Type
    Collection
    ...Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA.2 Venus, Cre-ERT2, targeting vector with MCS for homology...homology arms Mammalian Heller 112623 pEHC_PGKneoLox2DTA.2 Emerald, Cre-ERT2, targeting vector with MCS for homology... arms Mammalian Heller 112624 pmTHC_PGKneoLox2DTA.2 TFP, Cre-ERT2, targeting vector with MCS for homology...arms Mammalian Heller 112625 ptdTHC_PGKneoLox2DTA.2 tdTomato, Cre-ERT2, targeting vector with MCS for ...25;1504(4):467-86. doi:10.1016/0022-2836(81)90375-2. PubMed . Ventura A, Meissner A, Jaenisch R, Jacks...optimized for yeast Gal1 Yeast Sandmeyer 26853 pBF3060 Cre codon optimized for yeast Gal1 Yeast Sandmeyer ... pSH62-EBD Cre-EBD - Estradiol-dependent control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70 Mammalian...

  10. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...Durocher et al. Nucleic Acids Research 2002 Jan 15;30(2):E9 A list of commonly-used bait and prey plasmids...low-affinity extracellular protein interactions. Sun Y, Gallagher-Jones M, Barker C, Wright GJ. Analytical Biochem...

  11. CRISPR Guide

    Type
    Collection
    ...Sequences Glossary Publications CRISPR Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic...systems enable researchers to target anywhere from 2 to 7 genetic loci by cloning multiple gRNAs into a... is included on the gRNA-containing plasmid, or a 2-plasmid system in which Cas9 must be delivered separately...library (panel E ). Remember - if you are using a 2-vector system, you will need to transduce cells that...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells expressing...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

  12. Antibody Production

    Type
    Collection
    ...for shipping stability by incubating at 37 °C for 2 weeks, freezing at -80 °C, thawing on ice, and then..., antibodies undergo a buffer exchange using centrifugal columns. The final formulation buffer is phosphate-buffered...

  13. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...sequence YFP Thorben Dammeyer 54520 mCherry-Peroxisomes-2 Peroxisome Peroximal Targeting Signal 1 (PTS1) mCherry...Centrin2 Centrioles (dependent on cell cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles...Golgi apparatus B4GALT1(1-61) mTurquoise2 Dorus Gadella 68073 GalToxBFP Golgi apparatus GalT signal anchor...

  14. TALEN Plasmids and Kits

    Type
    Collection
    ...Golden Gate TALEN Kit and are used in place of pTAL1, 2, 3, or 4. For both plasmids sequence positions 1214...-BB contains the GAL1 promoter, placing TALORs built into this vector under galactose-inducible expression...Bogdanove/Voytas) in order to generate TALORs (TAL Orthongal Repressors) that can be used to custom repress...

  15. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS, MT Targeted...or localization experiments Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...expression with N-terminal GFP pAG306GAL-ccdB - Yeast Gateway expression... vector (TEF1 promoter, CEN/ARS) pAG304GAL-ccdB - Yeast Gateway expression...expression vector (PGK1 promoter, 2μ) pAG305GAL-ccdB - Yeast Gateway expression...expression vector (PGK1 promoter, 2μ) pAG303GAL-ccdB - Yeast Gateway expression...

  16. Church Lab CRISPR Plasmids

    Type
    Collection
    ... gRNA_DNMT3b A gRNA to DNMT3b Yeast System: Table 2 To function in yeast cells, we designed Cas9 protein...budding yeast) from the TEF1 promoter 43804 p415-GalL-Cas9-CYC1t A human codon-optimized Cas9 for expression...expression in S. cerevisiae (budding yeast) from the GalL promoter 43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t A gRNA...

  17. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...BclI-SwaI none S. pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin... S. pyogenes Zhang gRNA Cloning Vector Bbs I ver. 2 85586 Mammalian BbsI None S. pyogenes H Fujii pX601...yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes...
Showing: 1 - 17 of 17 results