We narrowed to 538 results for: invs
-
TypeBlog Post...elements, but among the most important are the inverted terminal repeats (ITRs). ITRs are the elements...Study of the Effects by Sequence Truncation within Inverted Terminal Repeats (ITRs) on the Productivity, Genome...2020). Adeno-Associated Virus Serotype-Specific Inverted Terminal Repeat Sequence Role in Vector Transgene...Merten, O.-W., & Galibert, L. (2017). Impact of Inverted Terminal Repeat Integrity on rAAV8 Production ..., & Logan, G. J. (2019). A User’s Guide to the Inverted Terminal Repeats of Adeno-Associated Virus. Hum...2017). Deletion of the B-B’ and C-C’ regions of inverted terminal repeats reduces rAAV productivity but...
-
Enabling high school research at the Journal of Emerging Investigators
TypeBlog Post...we introduce you to the Journal of Emerging Investigators, an open-access journal that enables high school... the interview with the Journal of Emerging Investigators Podcast breakdown Intro Chapter 1 - Introduction...Olivia Ho-Shing, and the Journal of Emerging Investigators. Chapter 2 - Getting high school students and...achieving it. Chapter 5 - JEI's future - getting more involved in the classroom by building curricula and developing... -
Channelrhodopsins with improved light sensitivity for minimally-invasive optogenetics
TypeBlog Post...to access, which often forces scientists to use invasive measures to perform in vivo optogenetic experiments... channelrhodopsin-based optogenetics minimally-invasive, Frances Arnold’s lab and Viviana Gradinaru’s ...have photocurrent properties best suited for less-invasive optogenetics experiments. The sequences in this...paired with a systemic AAV allow for minimally-invasive optogenetics While ChRgers performed well in a... see if they were suited for in vivo minimally invasive optogenetics. Both experiments delivered ChRgers... In the first experiment, ChRger2 was non-invasively delivered to the dopamine producing neurons in..., ChRger2 was delivered and activated with non-invasive methods to the neurons in the right secondary ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...of the DNA rearrangement after recombination (inversion, deletion, or translocation) depends on the orientation...opposite directions, recombination results in an inversion and the region of DNA between the target sites... loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer (34 bp) lox2272, lox5171...Dre rox TAACTTTAAATAATgccaATTATTTAAAGTTA 14 bp inverted repeats + 4 bp spacer (32 bp) Currently, only ...GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8 bp spacer (48 bp or 34 bp) F3, F5,...arranged, recombinases can be used for more than inversion, deletion, or translocation of a gene of interest...flip-excision”): Also known as DIO (Double-floxed Inverse Open reading frame), this system allows scientists... -
COVID-19 Resources
TypeCollection...infection, such as ACE2 and TMPRSS2, which are involved in the entry of SARS-CoV and SARS-CoV-2. Find ...protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme...superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 4 ) Cathepsin L -...infectivity.( 6 ) PCP4 - (Purkinje cell protein 4) is involved in beating of airway cilia.( 7 ) Cytokines - SARS-CoV... BSG - Wang, K et al, 2020, BioRxiv SARS-CoV-2 invades host cells via a novel route: CD147-spike protein... -
CRISPR Guide
TypeCollection...Multiplex Genome Engineering Many CRISPR experiments involve editing more than one gene. In these cases, delivering...using Cas9 to generate large genomic deletions or inversions with two gRNA sites on the same chromosome. Most...phases. Chemically or genetically inhibiting genes involved in NHEJ or upregulating those in the HDR pathway...flexible than base editing: it can encode edits involving any new sequence (point mutations, insertions,...for conducting genome-wide screens using CRISPR involves pooled lentiviral CRISPR libraries. Figure 8: ...Modifications Using CRISPR A variation of CRISPRi/a involves dCas9 fused to epigenetic modifiers. These programmable...off-target alterations, such as small mutations or inversions, than do large deletions generated by Cas9 systems... -
CRISPR History and Development for Genome Engineering
TypeCollection...as a powerful defensive strategy against viral invaders, and this system is proving to be just as useful...CRISPR-associated (Cas) genes to not only store a record of invading phages but also to destroy the phages upon re-... the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous...to ensure prokaryotic survival, but it is not invincible. Bondy-Denomy et al. identified the first set... -
Brzezinski Lab CRISPR Collection
TypeCollection...CRISPR plasmids to study the regulatory networks involved in retinal development....Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...aide in their studies of the regulatory networks involved in retinal development the lab utilizes a CRISPR... -
Validated gRNA Sequences
TypeCollection... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A... -
Luciferase Plasmid Collection
TypeCollection...212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz...hRlucCP/Puro) RapidResponse™ Renilla Vector for investigating regions controlling transcription Pete Stecha...212933 pGL4.82(hRluc/Puro) Renilla Vector for investigating regions controlling transcription Pete Stecha... -
Zhang Lab CRISPR Page
TypeCollection...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9... -
Impact of Genomic Variation on Function (IGVF) Consortium Collection
TypeCollection... plasmid tools generated by IGVF Consortium investigators to examine how genomic variation affects genome...collaborative program that brings together teams of investigators who will use state-of-the-art experimental and... -
NETRF
TypeCollection...from the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution... -
Serotype Testing AAV
TypeCollection...experiments. For more information, see our full AAV inventory or our AAV production page . Note: For a list ...100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample... -
Lentiviral Prep Service
TypeCollection...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified...Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more information... -
Ras Pathway
TypeCollection...variety of pathways, which ultimately turn on genes involved in cell growth, differentiation and survival. ...Transcription factor Dp TIAM TIAM1 TIAM2 T-cell lymphoma invasion and metastasis TP53 Tumor protein p53 TSC TSC1... -
Neurodegeneration Research Collection
TypeCollection...symptoms through medication and surgery. PD primarily involves the malfunction and death of dopamine-producing...other large scale studies. Researchers are now investigating the role that these additional genes may play... -
Fluorescent Protein Guide: Biosensors
TypeCollection... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate... -
Bacterial Expression Systems
TypeCollection...producing high amounts of protein. Whether you're investigating basic bacterial gene biology or engineering ...containing recombinases to induce targeted genetic inversion, deletions, and translocations events. Visit our... -
Immunology Research Plasmids and Resources
TypeCollection...immunology collection contains plasmids for genes involved in innate and adaptive immune signaling and cell-cell...such as macrophages and neutrophils that attack invading pathogens. Innate immune cells also process and...membrane and can also function as signaling proteins involved in proliferation, cell differentiation, and apoptosis...molecule, major histocompatibility complex, class II invariant chain DHLAG, HLADG, Ia-GAMMA CD8A CD8a molecule...