We narrowed to 277 results for: mel
-
TypeCollection...described in detail for murine erythroleukemia (MEL) cells, a suspension cell line. The culture medium...streptomycin and 1% L-glutamine, which is used for MEL cells. However, transient transfection of CRISPR/...transfection strategies for each cell type. While MEL cells are suspension cells, instructions for adherent...
-
Year of the Camelid: Antibody Style
TypeBlog Post...we love camelids too, though not just for the reasons the UN describes. In honor of the Camelid family,...through biomedical research. The Camelid family is composed of camels, llamas, and alpacas (and their ...Assembly has declared 2024 the International Year of Camelids. The declaration is intended to raise awareness...discovered heavy-chain only antibodies in the serum of a camel and soon after found similar antibodies in llamas... long until the field was off and running with camelid-derived single-domain antibodies (sdAb), commercially...development, the process started with immunizing a camelid (usually llamas or alpacas). But because sdAbs ...work done developing transgenic mice that express camelid variable domains (aka nanomice), which gives researchers... -
CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]
TypeBlog Post...video details how to transfect CRISPR plasmids into MEL cells by electroporation, sort your transfected cells... -
5 Tips for Troubleshooting Viral Transductions
TypeBlog Post...): C386-C392. PubMed PMID: 16510845. 4. Krajden, Mel, et al. "Effect of multiple freeze-thaw cycles on... -
Immunology Research Plasmids and Resources
TypeCollection...myostatin GDF8 MTNR1A melatonin receptor 1A MEL-1A-R, MT1 MTNR1B melatonin receptor 1B MEL-1B-R, MT2 NAMPT ...ATGR2, MRX88 AMBN ameloblastin (enamel matrix protein) - AMELX amelogenin (amelogenesis imperfecta 1, X-...TNFR-RP, TNFR2-RP, TNFRSF3 MC1R melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) ...SHEP2 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) ACTHR, MGC125798 MC3R melanocortin 3 receptor...MC3-R, OB20, OQTL MC4R melanocortin 4 receptor MGC126851, MGC138197 MCHR1 melanin-concentrating hormone...PMCH pro-melanin-concentrating hormone MCH PNOC prepronociceptin PPNOC POMC proopiomelanocortin ACTH, CLIP...GPRV28, V28 CXCL1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) FSP, GRO1,... -
Malate Dehydrogenase CUREs Community Collection
TypeCollection...set of wild-type malate dehydrogenase genes and watermelon mutant clones for your course-based undergraduate...genes from several species and mutant clones from watermelon have been codon-optimized for expression in bacteria...plasmids based on: Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic... -
Validated gRNA Sequences
TypeCollection... 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello AXIN2 H. sapiens...GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186... -
Synthetic Biology - Overview
TypeCollection...Maharbiz Thorsten Mascher Kathleen Matthews Anastasios Melis Aindrila Mukhopadhyay Richard Murray Erin O'Shea...Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela Silver Lei Stanley Qi Jeff Tabor Jan-Willem Veening... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...and Cap2 Melina Fan 104964 pAAV2/5 AAV5 AAV packaging plasmid, expressing Rep2 and Cap5 Melina Fan 240485... -
CRISPR Pooled gRNA Libraries
TypeCollection...Neelamegham 3rd 10 3,637 Oxford Fly 64750 Knockout D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library...Mouse Metabolism Library 163966 Knockout Mouse Kimmelman 3rd ~6 18,343 Human UBDUB CRISPR Knockout Library... -
Tetracycline Inducible Expression
TypeCollection...inducing a potentially toxic protein you may need extremely minimal background expression and only moderate...discriminating between neurons. Takeshi Imai 155257 Watermelon Pooled Library Lentiviral barcode library for... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Sep 8. Robert Campbell Calcium D and D2 family Cameleon calcium sensors Bcl-2-mediated alterations in ... yellow-, or cyan-emitting homoFRET/anisotropy Cameleon calcium sensors Single-color, ratiometric biosensors... -
Neurodegeneration Plasmid Collection
TypeCollection...T7 Huntington's Pamela Bjorkman 11514 pET32a-HD39Q HTT His, Trx T7 Huntington's Pamela Bjorkman 11515 ...11487 pET32a-HD16Q HTT His, Trx T7 Huntington's Pamela Bjorkman 11503 pBabe neo human Frataxin FXN Friedreich...11515 pET32a-HD46Q HTT His, Trx T7 Huntington's Pamela Bjorkman 12165 pSico Dnmt1 DNMT1 GFP CMV Hereditary...pCDNA3-IgL-C99-T4L-rTA APP CMV Alzheimer's Karsten Melcher 178115 ANG_Halo_C_allele ANG Halo ALS Michael Ward... -
Cancer Research Plasmids and Resources
TypeCollection...their location, their pathway dependencies are extremely important for classification and treatment. On... -
Antibody Plasmid Collection
TypeCollection...bodies to fight off intruders, antibodies are also extremely useful to researchers in a lab. When an antibody... -
Worm Expression Resources
TypeCollection...detection of genome-editing events. Developed in Craig Mello's lab and described in A Co-CRISPR Strategy for Efficient... -
p53 Pathway
TypeCollection...of p53-mediated tumour suppression. Bieging KT, Mello SS, Attardi LD. Nat Rev Cancer. 2014 May;14(5):359... -
CRISPR Guide
TypeCollection...A., Waldhauer, M. C., Börner, K., Fakhiri, J., Schmelas, C., Dietz, L., Grimm, D., Correia, B. E., Eils...Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., ... -
Brain Armamentarium
TypeCollection...Allen Institute for Brain Science , Bosiljka Tasic Melina Fan 214869-PHPeB AiP15140: pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3... -
TALEN Plasmids and Kits
TypeCollection...germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids...