We narrowed to 967 results for: Cre
-
TypeCollection...paper . How to Cite this Kit These plasmids were created by your colleagues. Please acknowledge the Principal...Investigator, cite the article in which they were created, and include Addgene in the Materials and Methods...
-
CRISPR Plasmids and Resources
TypeCollection...Other Applications Screen CRISPR libraries are a powerful tool for genome-wide screening. Purify dCas9 fused... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...each (these can be built into PCR primers when creating a new part, with an additional 5' clamping sequence...Features: Modified RFC 10 w/ start and stop codons; Creates in-frame fusions w/ linker Thr-Gly; Use N-parts... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol... fractions followed by silver stain. Note the increased number of contaminants in each fraction. * AAV... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...for 5 min. Note: Ribonuclease A (RNase A) is a pancreatic ribonuclease that digests single-stranded RNA... -
Viral Vector Guides and Plasmids
TypeCollection...generate viral vectors for research and gene therapy. Created with BioRender.com. Wild-type viruses have one ...vehicles to deliver genetic cargo into cells. To create safe and effective viral vectors, wild-type viral... -
CRISPR Plasmids - Prime Edit
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...another round. Figure 1: Overview of prime editing. Created with BioRender.com. The original prime editing ... -
Microbiology Resources
TypeCollection...used to reconstitute self-replicating microbes or recreate the diseases they cause. The standard format for...system - Wittbrodt Lab MultiSite Gateway Kit : Creating three-part fusion proteins - Planas and Santalucia... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection... used in the creation of the hiPS cell lines The following plasmids can be used to create cell lines with... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...indicates the presence of primer dimers which can increase background signal and alter the Ct values of your... -
Lentiviral Prep Service
TypeCollection...Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes involved in specific... -
Western Blot
TypeProtocol... have moved out of the wells and into the gel. Increase the voltage to 150 V and continue running the ... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also... -
Rett Syndrome
TypeCollection...available directly from the labs in which they were created. Find their contact information by following the... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
Genetic Code Expansion
TypeCollection...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ...to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church " 68306 C321.ΔA all... -
TREAT-AD Plasmid Collection
TypeCollection...validated resources for emerging targets in AD and creating high-quality, well-characterized lead molecules... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection... Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...backbone with different fluorescent tags for you to create fusion proteins with your gene of interest. Most... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors...