We narrowed to 969 results for: Cre
-
TypeCollection...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also...
-
Fluorescence Titering Assay
TypeProtocol... remove cells and debris. Lentiviral titer can decrease during cycles of freeze-thaw. If you are freezing... -
Molecular Biology Protocol - Restriction Digest of Plasmid DNA
TypeProtocol...(for instance, in a diagnostic digest), you can create a "Master Mix" consisting of all of the reaction... -
Protocol - How to Ligate Plasmid DNA
TypeProtocol...the reaction size as necessary - being sure to increase the amount of buffer proportionally. 1μL of ligase... -
Rett Syndrome
TypeCollection...available directly from the labs in which they were created. Find their contact information by following the... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol... fractions followed by silver stain. Note the increased number of contaminants in each fraction. * AAV... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...for 5 min. Note: Ribonuclease A (RNase A) is a pancreatic ribonuclease that digests single-stranded RNA... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...indicates the presence of primer dimers which can increase background signal and alter the Ct values of your... -
Western Blot
TypeProtocol... have moved out of the wells and into the gel. Increase the voltage to 150 V and continue running the ... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
Genetic Code Expansion
TypeCollection...cells. Many of these sets have been mutated and screened through directed evolution to charge the tRNA ...to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church 68306 C321.ΔA all ... -
TREAT-AD Plasmid Collection
TypeCollection...validated resources for emerging targets in AD and creating high-quality, well-characterized lead molecules... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection... Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...backbone with different fluorescent tags for you to create fusion proteins with your gene of interest. Most... -
CRISPR Plasmids - RNA Editing
TypeCollection...adenosine deaminase to catalytically dead Cas13b creates a programmable RNA editor that converts adenosine... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors... -
MAPK Plasmids
TypeCollection... plasmid collection for community. If you have created plasmids containing MAPK and would like to add ... -
Fluorescent Protein Guide
TypeCollection...community-editable database for fluorescent proteins created by Talley Lambert. Nikon MicroscopyU (Link opens... -
Zinc Finger Consortium: Nuclease Expression Vectors
TypeCollection...nucleases in different cell types. Zinc finger arrays created using ZFC reagents for either OPEN or modular assembly... -
Cancer Research Plasmids and Resources
TypeCollection... Tackling Cancers’ Drug Resistance with a New Screening Kit (David Sabatini & Kris Wood) National Cancer...