We narrowed to 960 results for: Cre
-
TypeCollection...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also...
-
Rett Syndrome
TypeCollection...available directly from the labs in which they were created. Find their contact information by following the... -
Genetic Code Expansion
TypeCollection...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ...to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church 68306 C321.ΔA all ... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
Protocol - How to Design Primers
TypeProtocol...also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification process... -
Protocol - Over-Agar Antibiotic Plating
TypeProtocol... to do the spreading; the tip is gently bent to create an “L” shape, and then used like a cell spreader... -
Protocol - How to Purify DNA from an Agarose Gel
TypeProtocol...better resolution of bands? A couple simple ways to increase the resolution (crispness) of your DNA bands include... -
Protocol - How to Perform a Diagnostic Digest
TypeProtocol...with both and seeing both patterns you can be incredibly confident that you have the correct plasmid. ... -
Fluorescence Titering Assay
TypeProtocol... remove cells and debris. Lentiviral titer can decrease during cycles of freeze-thaw. If you are freezing... -
Molecular Biology Protocol - Restriction Digest of Plasmid DNA
TypeProtocol...(for instance, in a diagnostic digest), you can create a "Master Mix" consisting of all of the reaction... -
Protocol - How to Ligate Plasmid DNA
TypeProtocol...the reaction size as necessary - being sure to increase the amount of buffer proportionally. 1μL of ligase... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol... fractions followed by silver stain. Note the increased number of contaminants in each fraction. * AAV... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...for 5 min. Note: Ribonuclease A (RNase A) is a pancreatic ribonuclease that digests single-stranded RNA... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...indicates the presence of primer dimers which can increase background signal and alter the Ct values of your... -
Western Blot
TypeProtocol... have moved out of the wells and into the gel. Increase the voltage to 150 V and continue running the ... -
TREAT-AD Plasmid Collection
TypeCollection...validated resources for emerging targets in AD and creating high-quality, well-characterized lead molecules... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection... Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...backbone with different fluorescent tags for you to create fusion proteins with your gene of interest. Please... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors... -
MAPK Plasmids
TypeCollection... plasmid collection for community. If you have created plasmids containing MAPK and would like to add ...