We narrowed to 8 results for: Cre

...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...

...if one fragment of a protein of interest, such as Cre recombinase, is fused to Cry2 and the other fragment...combined with site-specific recombinase systems like Cre-lox , which allows you to express an opsin only in...using a viral vector with a floxed opsin in a VGAT-Cre animal will result in expression of the opsin only...

... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Download our chemogenetics poster: References...

...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...

...CRISPR check out our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits...

...mutations or transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...

...under strong neuron-specific promoters or neural Cre-dependent expression, to visualize connections between...

...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...