Skip to main content

We narrowed to 17 results for: Cre

Showing: 1 - 17 of 17 results
  1. Optogenetics Guide

    Type
    Guide
    ...combined with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only...Alternatively, when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half .... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...
  2. Sequencing Primers

    Type
    Guide
    ...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1...
  3. Chemogenetics Guide

    Type
    Guide
    ... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Want to know more about FLEx vectors... G-protein and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...(R165L) Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al.,...M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing Guettier et al., 2009...
  4. Adenovirus Guide

    Type
    Guide
    ...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors...
  5. CRISPR Guide

    Type
    Guide
    ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 - ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 - increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...
  6. Guide to Using Pooled Libraries

    Type
    Guide
    ...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...reproducibility. Types of Pooled Library Screens In pooled library screens, cells are infected at a very low ... cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection Most cells... of the selection mechanism Positive Screen In a positive screen, the goal is to identify those cells ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New...
  7. Lentiviral Vector Guide

    Type
    Guide
    ...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...Figure 2: First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation...Figure 3: Second-generation lentiviral plasmids. Created with BioRender.com. Third-generation The third-...
  8. Plan Your Experiment

    Type
    Guide
    ... mutant allele of a gene (point mutant)? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity Dual-nickase approach increases specificity but is less ...efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides ... the general framework of a CRISPR experiment. Created with BioRender.com. Select Your Desired Genetic...mammalian cell lines Interfere Activate (CRISPRa) Increase gene expression without permanently modifying ...likely won’t be able to completely avoid them. To increase specificity, consider using an engineered Cas ...target in your samples to ensure there are no discrepancies with the reference sequence you used for gRNA...
  9. Modular Cloning Guide

    Type
    Guide
    ...) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete and Detect Yeast...It is a powerful and very efficient method for creating many plasmids from different combinations of a... directionally assembled into a Level 1 vector creating a single transcriptional unit (for example, a ...Combining multiple Level 2 vectors permits the creation of even more complex constructs constrained only...for cloning and assembling standardized parts to create eukaryotic multigene constructs. MoClo Plant Parts...System Plant Expression Jan Lohmann 56 plasmids to create plant expression vectors containing several cassettes...with additional Level 0 modules and components to create plasmids with multiple transcriptional units. MultiGreen...
  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...under strong neuron-specific promoters or neural Cre-dependent expression, to visualize connections between... hybrid capsids, and capsids created through directed evolution. Created with BioRender.com. Common Uses...for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com. AAVs are part of the Dependoparvovirus...-type AAVs have been modified by researchers to create recombinant adeno-associated viral (rAAV) vectors... Plasmids required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning... Figure 3: Overview of rAAV vector production. Created with BioRender.com. Genome Integration Recombinant...it is likely that this number will continue to increase. This diversity makes rAAV vectors a very useful...
  11. Cloning

    Type
    Guide
    ...the gap created by the 5’ exonuclease and finally ligase seals the nicks in the DNA to create one piece...Cloning Oligo Stitching Molecular cloning or the creation of recombinant DNA is an essential process used...several of the most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction...compatible attP sites via a proprietary BP clonase (creating an entry clone). The entry clone now has recombined...restriction enzymes or an exogenous ligase providing an incredibly quick and easy way to clone a fresh PCR product...available TOPO® ready, and it is not feasible to create a TOPO® vector yourself. Additionally, the efficiency...distal to their recognition site allows for the creation of custom overhangs, which is not possible with...
  12. Antibody Guide

    Type
    Guide
    ... cell cultures using hybridomas, cell cultures created by fusing B cells with myeloma cells (immortalized...immortalized B cells). The genetic reorganization that creates variety in the antibody allowing for their extreme...animals immunized as described above are used to create hybridomas, which produce large amounts of a single...recombinant antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma...goes through a randomized reorganization process, creating a unique binding site. This process, known as ...roles in the immune response, and can be used to increase flexibility or specificity in antibody-based methods... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects...
  13. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...scientists have made changes to these components for increased safety when producing viral vectors in a laboratory.... Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com. All gamma-retroviral vectors...distinct plasmids for safety to reduce the chance of creating replication-competent retroviruses. For a summary...tropism). Figure 2: Gamma-retroviral plasmids. Created with BioRender.com. Gamma-Retroviral Vector Production... 3: Gamma-retroviral vector packaging methods. Created with BioRender.com. Viral Vector Integration Much...genome and the cells that survive can be expanded to create stable cell lines. The cell lines will have the...transcription. Removal of this region in the 3’ LTR creates self-inactivating viral vectors. R in cis Repeat...
  14. Molecular Biology Reference

    Type
    Guide
    ...study DNA fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids ... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles, such as lentiviral, retroviral...used in place of ampicillin. Preparing Antibiotics Create a stock solution of your antibiotic. Unless otherwise...
  15. Educational Resources

    Type
    Guide
    ...Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol Stocks Restriction Digests ...
  16. Science Guides

    Type
    Guide
    ... Science Guides Addgene has created the following guides to help you start learning...
  17. Addgene's eBook Collection

    Type
    Guide
    ...and how to use pooled libraries in genome-wide screens. Close About Overlay Select Fluorescent Proteins...
Showing: 1 - 17 of 17 results