...markers. The FP together with the protothropic cassette can be amplified with the following primers: FW...Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit Other Plasmids Bas Teusink Lab Materials...in a new window) Sheff MA, Thorn KS. Optimized cassettes for fluorescent protein tagging in Saccharomyces...Bydder SF, Zhou Y, Nielsen LK. Dual gene expression cassette vectors with antibiotic selection markers for ...

...shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs 11619...shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler 1730... plasmid with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned ...interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3´-LTR). See...

...deletion in E3 and insertion of GFP expression cassette. Bunz 179202 pAd5-B6/7 ∆E3-GFP Adenoviral A block...deletion in E1 and insertion of GFP expression cassette. Bunz 16402 pShuttle Shuttle For production of...Shuttle Modified pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang 50957...

...-ko-sgRNA1-SpCas9 TARDBP U6 ALS Rajat Rohatgi 107858 pHBS953 TARDBP-Exon2-ko-sgRNA2-SpCas9 TARDBP U6 ALS...Patrick Caswell 179900 pJET-59-DExCon-mTagBFP2-R25 RAB25 mTagBFP2 TRE3GS Parkinson's Patrick Caswell 180016...sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-Cas9 HTT U6, 7sk...MS2 CMV Parkinson's Niels Gehring 66818 pCCL-PGK-SPdCas9-BFP-DNMT1 DNMT1 PGK Hereditary sensory neuropathy...Episodic ataxia Xiaolong Wang 159912 pAAV-CMV-FLEX-SaCas9-U6-sgKcnd3 HTT CMV Huntington's Larry Zweifel 160435...Wernig 176852 UBQLN2_450-624W UBQLN2 T7 ALS Carlos Castañeda 176915 pcDNA3.1(+)_Paragranulin+linker 1 GRN...Parkinson's Frank Soldner 180437 Px330-EGFP-LRRK2-CRISPR/Cas9 LRRK2 U6 Parkinson's Frank Soldner 180439 STR-KDEL_PGRN-SBP-mCherry...

...the stuffer. The AgeI site is destroyed in most cases (depending on the target sequence), while the EcoRI...

...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...

...Oct4, Sox2, Klf4, and c-Myc from polycistronic cassettes KLF4 N-terminal variance modulates induced reprogramming...Oct4, Sox2, Klf4, and c-Myc from polycistronic cassettes. piggyBac transposition reprograms fibroblasts...CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms of Neurological Disease in Mice...

...photoswitchable control of inhibitory GPCR signaling cascades. Michael Bruchas 139505-AAV8 pAAV-Ef1a-DIO-PPO-Venus...photoswitchable control of inhibitory GPCR signaling cascades. Michael Bruchas 139505-AAV9 pAAV-Ef1a-DIO-PPO-Venus...photoswitchable control of inhibitory GPCR signaling cascades. Michael Bruchas 140135-AAV1 pAAV-EF1a-iCreV can...

...cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven, Cre-dependent Cre-dependent, ..., bicistronic expression of designer pro-taCasp3 and TEVp for studying cell ablation. 5 Shah , Wells Don...

...titered by droplet digital PCR (ddPCR) . In some cases, we may expect lower titers for a particular AAV...titer due to toxicity or other reasons For these cases, Addgene will promptly notify you by email within...

...Site (5' to 3'; half-sites in CAPS, spacer in lowercase) aak1 TAL3208 & TAL3209 TCTTTGACTCCCGGAGAGagctggtgggctccgggCCAGGTTCTGGAGGGGGA...TGGACGCGGAGCTGTTCTcggagcaggagctgacCTGCTCCATCTGTCTGGA casp8ap2 TAL3038 & TAL3039 TATAACAAATCCCACCACattgcccgatatcttgAATACTTCCAAAACAAAA...

... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of ...of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of...

...the plasmids to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA ... Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those...information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out ...popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries Enable Genome-Scale,...

...is an oncogene) and should be considered on a case by case basis. Biosafety should always be considered...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival strain...to recombine with the destination vector (in this case the destination vector would be the lentiviral transfer...

...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...

...Locus-specific ChIP technologies (iChIP & enChIP) using dCas9 - H. Fujii Disease Research Michael J. Fox Foundation...

...mammalian cells or zebrafish). pMG10 (a '“2-in-1” ZFN cassette for expression of both a “+” and “-” heterodimeric...

...Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation genome editing of human TP53...

...GAPs: concepts and challenges Sztul E, Chen PW, Casanova JE, Cherfils J, Dacks JB, Lambright DG, Lee FS...

... contamination. To date, Addgene has never had a case of mycoplasma contamination. In the event of contamination...