We narrowed to 412 results for: his
-
TypeCollection...state of each cell in a population. Proliferation history is monitored by the dilution of a dox-inducible...
-
Validated gRNA Sequences
TypeCollection...GGGACCTGACCGGCCGCAGG 42245 cut S. pyogenes 23360964 Joung his3 S. cerevisiae ATTGCGATCTCTTTAAAGGG 64333 cut S. ... -
Brain Initiative Collection
TypeCollection...separated by cleavable peptide sequence P2A. Mark Histed 179459-AAV1 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE Double... -
CRISPR Guide
TypeGuide... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post..., Bert et al 2000). In 2000, Peter Cockerill and his lab developed an improved luciferase reporter gene...respond to their environment - typically through a histidine kinase, which triggers phosphorylation of the ... -
Flow Cytometry Readouts: Yes, No, and Everything in Between
TypeBlog Post...dot plot, looking at a histogram vs antibody plot would be better. The histogram shows peaks of high signal...gates, just based on a histogram plot instead of a dot plot. However, the histogram plots look a bit different...lower signal, or downregulation. Figure 3 shows a histogram for a yes-no dot plot, like the one shown in Figure... Figure 1. Figure 3: An example of a histogram plot for a yes/no flow cytometry readout. Created...Created with biorender.com. Using histogram plots to quantify smeary plots For smeary expressions, ...for a signal peak that shifts to the right on a histogram plot and lower for a signal peak that shifts to...for yes-no readouts. Figure 4: A histogram plot for a smeary antibody readout. The orange... -
Illuminating Epigenetics with A FRET Based Biosensor
TypeBlog Post...substrate (the histone-derived peptide) which can localise the construct specifically to the histone protein ...target the K9 (pcDNA3-K9 histone methylation reporter) and K27 (pcDNA3-K27 histone methylation reporter) ... remodeling. Chromatin is a complex of DNA and histone proteins that compacts cellular DNA into chromosomes...dangerous DNA damage. If the way DNA is wrapped around histones changes, then gene expression can change as well...The more frequently and tightly bound DNA is to histones, the more compacted it becomes. This prevents ...can occur by two main mechanisms, either through histone modifications, which can influence the transcription...plasmid-based biosensor to visualise changes in histone methylation in living cells. Essentially this reporter... -
Antibodies 101: Avoiding the Mouse on Mouse Mess in IHC
TypeBlog Post...human cryostat tissue sections. J Histochem Cytochem : Off J Histochem Soc 38:923–926. https://doi.org/...Fighting with antibodies to produce immunohistochemistry images that are crisp, bright, and lacking in...avoiding background secondary binding Direct immunohistochemistry (Figure 2A) How do you avoid having your...Randolph-Habecker J (2013). A Flexible Mouse-On-Mouse Immunohistochemical Staining Technique Adaptable to Biotin-Free...Immunofluorescence, and Multiple Antibody Staining. J Histochem Cytochem 62:197–204. https://doi.org/10.1369/0022155413511620...Monoclonal Antibody to Mouse Tissue Sections. J Histochem Cytochem 46:977–983. https://doi.org/10.1177/002215549804600813...Tuson JR, Pascoe EW, Jacob DA (1990) A novel immunohistochemical technique for demonstration of specific binding... -
CRISPR 101: Epigenetics and Editing the Epigenome
TypeBlog Post...field in which covalent modifications to DNA or histones, the proteins that help package DNA, were associated...modifications, researchers used blunt tools like histone deacetylases, but targeted epigenetic modification...researchers additionally fused a TAL effector to LSD1 histone demethylase to demethylate enhancer regions (Mendenhall...regulate transcription, also includes light-regulated histone methyltransferases and deacetylases. CRISPR and... acetyltransferase increases levels of H3K27ac histone modification at specified loci. Charles Gersbach... Figure 1: dCas9-p300 adds H3K27ac marks to histones in promoter and enhancer regions. These marks ... for targeted removal of H3K4me1/2 and H3K9me2 histone modifications. Like the TALE-LSD1 system described... -
Why and how to start studying chromatin (with Addgene's help)
TypeBlog Post...CUL1 H2AFX H2AFY H3F3A H3.1 H3.3 HIST1H1E HIST1H2BB HIST2H2BE RBX1 STAG2 Xist Your favorite gene...context of chromatin?” Though it’s true that adding histones and chromatin architecture to every diagram portraying...transcription of a gene a megabase away, or looking at the histone methylation status at a double-strand break that...2018 Keystone meeting for Chromatin. Note that histone genes frequently have many different variant names...RANbodies) as versatile, small, sensitive immunohistochemical reagents. Yamagata M, Sanes JR Proc Natl ... -
Synthetic Photobiology: Optogenetics for E. coli
TypeBlog Post... also be used to engineer new pathways with sophisticated gene expression controls. Most cell types do...two-component systems (TCSs). TCSs consist of a histidine kinase that phosphorylates a response regulator...domain from cyanobacteria to a common E. coli histidine kinase. This hybrid construct senses light, and...light; these two systems can be coexpressed for sophisticated control of gene expression. An E. coli light-sensitive...light-sensitive two-component system (TCS). A hybrid histidine kinase/photosensor senses various light inputs... -
Hot Plasmids - November 2023
TypeBlog Post...proximity labeling and TransitID Tracking cellular history with protein ticker tape Teaching an old antibody....1101/2023.02.07.527548. Tracking cellular history with protein ticker tape By Brian O’Neill The Cohen...created a system for recording the transcriptional history of a cell. Lin et al. generated a fusion protein...ticker tape images could recover transcriptional histories, accurate to within 40 minutes. Figure ...their initial tests with thick slice (70 μm) immunohistochemistry (IHC) (Figure 5). PSD-95 is a scaffolding... -
Plasmids 101: Biotinylation
TypeBlog Post...situ hybridization histochemistry: use for mRNA detection.” The Journal of Histochemistry and Cytochemistry...interaction has also been adapted for use in immunohistochemistry and antibody labelling. In these experiments...referred to as the Avidin-Biotin Complex (ABC) immunohistochemistry (IHC). For more information on ABC and IHC...Cytochemistry : Official Journal of the Histochemistry Society, 41.12 (1993): 1751–1754.PubMed PMID: 8245422. Additional... -
Hot Plasmids: Summer 2024
TypeBlog Post...structures (at < 5 Å resolution) of the linker histone H1.8 in Xenopus nucleosomes and in complex with...has developed a new epigenetic editor, Coupled Histone tail for Autoinhibition Release of Methyltransferase...can be toxic, CHARM uses a cofactor fused to a histone tail to recruit and stimulate the endogenous methyltransferase...uses a fusion of the DNMT3L cofactor (D3L) with a histone tail (H3K4me0) to a DNA-binding protein (dCas9 ... a familiar challenge for anyone who has done histology on brain tissue is identifying the cells you are... -
New CRISPR Web Resources and #12DaysofCRISPR Recap
TypeBlog Post...is especially exciting, including histone acetylation by p300, histone demethylation by LSD1, cytosine ... subpages, our updated CRISPR Guide and CRISPR History provide a great overview of the development of ...resources: CRISPR Plasmids and Resources and CRISPR History and Development for Genome Engineering ... -
Choosing Your Perfect Empty Backbone
TypeBlog Post...epitope tag (6xHis or GST) to affinity purify the expressed protein with a specific resin (e.g. 6xHis containing...level expression? Finally, you can add bells and whistles to your construct. If you are planning to track...containing pDEST-HisMBP). After purification the protein can be released from the resin and used for various... -
Celebrate National Book Month with Addgene
TypeBlog Post...skeptical reader of historical fiction (I can personally attest to this!). Following history from the Ice Age...Strange & Mr. Norrell by Susanna Clarke "A quasi-historical/fantasy fiction. Two dueling magicians in the...of England by Edward Rutherfurd "A 10,000 year history of southern England. While the length may be intimidating... -
Uncovering Ancestral Bias in CRISPR Research
TypeBlog Post...Biomedical research has a long and well-documented history of racial bias, which still impacts and influences...ancestry. Understanding the impact Fig. 3: Histograms indicating the frequency (x-axis) which SNPs ...have approximately 20% more single nucleotide polymorphisms (SNPs) that map to guides in the Broad’s Genomic...Further complicating the issue is the long and ugly history of reporting false essentialist links between biology... -
Five Popular Model Organisms, Part 2
TypeBlog Post...are five more model organisms that have left a historical impact on the scientific community. (And, check... The E. coli genome has an extensive research history and characterization. Many proteins and processes...organisms in the world. With its extensive scientific history, highly characterized genome, and widespread utilization...organisms is its thoroughly developed and defined history in research (Krämer, 2015). As a result, a vast... -
Evolution of Lab Techniques
TypeBlog Post...that save both time and money. Yet, knowledge of historical techniques comes in handy whether you are perusing...technological innovations. Let’s take a look at three historical techniques: southern blotting, restriction mapping...throughout the world. Let us know your favorite "Historical Lab Technique" in the comments section below!...Benjamin Chain. "The sequence of sequencers: The history of sequencing DNA." Genomics (2015). PubMed PMID...