We narrowed to 5 results for: his

...E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H CAU, CAC Isoleucine Ile I AUU, AUC, AUA Leucine...Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK...

..., or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have weak signals...location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry (ICC) Cell Sorting...in these assays. This method is suitable for DNA:histone modifier interactions, which have strong binding...methods such as immunofluorescence (IF), immunohistochemistry (IHC), and immunocytochemistry (ICC) use... they only have one protein of interest. Immunohistochemistry (IHC) and immunocytochemistry (ICC) IF can... can refer to both immunohistochemistry and immunocytochemistry when fluorescent signaling molecules (...

...P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG...TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA...GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3'...

...factors and histones (proteins that package DNA into nucleosomes) also bind the TATA box. Histone binding ...

... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as...