We narrowed to 5 results for: his

1. Molecular Biology Reference

   Type

   Guide

   ...E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H CAU, CAC Isoleucine Ile I AUU, AUC, AUA Leucine...Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK...

2. Antibody Guide

   Type

   Guide

   ..., or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have weak signals...location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry (ICC) Cell Sorting...in these assays. This method is suitable for DNA:histone modifier interactions, which have strong binding...methods such as immunofluorescence (IF), immunohistochemistry (IHC), and immunocytochemistry (ICC) use... they only have one protein of interest. Immunohistochemistry (IHC) and immunocytochemistry (ICC) IF can... can refer to both immunohistochemistry and immunocytochemistry when fluorescent signaling molecules (...

3. Sequencing Primers

   Type

   Guide

   ...reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward...forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R,...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA...

4. Promoters

   Type

   Guide

   ...general transcription factor proteins and histones can bind. Histones are proteins found in eukaryotic cells...cells that package DNA into nucleosomes. Histone binding prevents the initiation of transcription whereas...

5. CRISPR Guide

   Type

   Guide

   ... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as...