Skip to main content

We narrowed to 296 results for: Ott;

Showing: 261 - 280 of 296 results
  1. Chemogenetics Guide

    Type
    Guide
    ..., Silvagnoli, A. D., Crespo, E. L., Schalau, R., Gott, M., Tree, M. O., Dunbar, G. L., Rossignol, J., ...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L...
  3. Antibody Guide

    Type
    Guide
    ...resulting light emissions. In FACS, cells are then slotted in a specific direction based on the emission(s...
  4. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Ankyrin-B Human Mouse IgG2a 177495 Anti-Ankyrin-G (blotting) [N106/20R] Ankyrin-G Human Mouse IgG2a 177496...
  5. Pouring LB Agar Plates

    Type
    Protocol
    ...appropriately sized bottle for autoclaving. We make 400 mL of agar in 1 L bottles and 200 mL of agar in...to the same bottle and swirl to form a medium/agar colloid. Cover the opening of the bottle with its cap...Use lab tape to label the bottle with your initials, the date, and the bottle contents. This will clear... in 500 mL bottles. The extra empty volume is necessary to prevent your molten agar from boiling over ...but do not make an air-tight seal!) and tape the bottle with autoclave tape. The autoclave tape will darken...clear up any confusion later if your forget your bottle in the autoclave. Place the gel mix in the autoclave...pouring your plates - be sure to leave room for your bottle of molten gel mix, a tube rack containing the appropriate...
  6. AAV Production in HEK293 Cells

    Type
    Protocol
    ...a sterile 250 mL bottle. Aliquot 774 mL of DMEM + 2% HI-FBS into a sterile 1 L bottle. Add each plasmid...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated... mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized water + 100 mL of 1 M Tris HCl...Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting multiple times Adjust pH to...complete media, then transfer the cells into a sterile bottle. Rinse the CS2 with 100 mL of DMEM complete medium...plasmid DNA into the bottle containing the Opti-MEM. Mix well. Add 4 mL of PEI (1:2 μg DNA to μg PEI ratio...ratio). Shake the bottle up/down vigorously for 30 sec (it’s okay to make bubbles). Incubate at RT for 15...
  7. Western Blot

    Type
    Protocol
    ...separator. Keep the Bottom Stack in the plastic tray. Place the Bottom Stack on the blotting surface. Align...lysate, running a precast SDS-PAGE gel, and immunoblotting. Protocols...lysate, running a precast SDS-PAGE gel, and immunoblotting. Sharing speeds science. We believe that sharing... gels. Use lower percentage acrylamide when immunoblotting high molecular weight proteins and higher percentage... percentage acrylamide when immunoblotting low molecular weight proteins. This protocol uses a dry transfer...instructional video to learn how to use western blotting to visualize a protein from cells or tissue samples...Align the electrical contacts on the blotting surface of the iBlot 2 Gel Transfer Device. Wet the pre-run...
  8. Water Bath Protocol

    Type
    Protocol
    ...water bath weights can hold bottles in place. After putting your tubes or bottles in the water bath, place...baths that exist as scientists work with tubes and bottles of different sizes in the lab. Some water baths...water baths hold many liters of water to incubate bottles and containers. Water baths can also be placed ...be used in water baths with instructions on the bottle, for example, number of drops per liter. Place ...floating, you do not need to necessarily maneuver the bottles or tubes to identify them. Once the water bath ...temperature, remove the lid and place your tubes or bottles into the water bath. Many items may float in the...
  9. Pipetting Protocol

    Type
    Protocol
    ...Containers to hold measured liquid (ex: microfuge tube, bottle, etc.) Labels for containers Reagents Liquid for...the the pipette, and the tip ejector ring at the bottom which pushes the pipette tip off of the pipette...Therefore, 1000 µL would read as 100 from top to bottom (as shown in the picture above), while 650 µL would... Therefore 100 µL would read as 100 from top to bottom (as shown in the picture above), while 95 µL would...pipettes will also have small tick marks at the bottom. For the P1000, this represents the ones. For the...measured liquid (ex: another microcentrifuge tube, a bottle etc.). If there is already other liquid in the ...this is a new container, place the tip near the bottom of and gently in contact with the container (capillary...
  10. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...Loosely close the cap on the bottle (do NOT close all the way or the bottle may explode!) and then loosely...LB, weigh out the following into a 500 mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH...loosely cover the entire top of the bottle with aluminum foil. Autoclave and allow to cool to room temperature...temperature. Now screw on the top of the bottle and store the LB at room temperature. When ready to grow ... 1: Media without growth (top) and with growth (bottom). Preparing Antibiotics Create a stock solution...
  11. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG ). The bottom oligo will be the reverse compliment so that they... - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5... the top oligo and 3' - G and CAGCT - 5' to the bottom oligo, making our final oligos 34 bp each: Top ... - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...oligo: 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG ...
  12. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...pH 9.0, Millipore Sigma T2819-1L 250 mL sterile bottle, VWR 430281 0.45 µm PES complete filtration unit...clamp on a clamp stand. Use scissors to cut the bottom of the Gravitrap column at the indentation in the...Gravitrap column. Collect the flow through in a 250 mL bottle. Repeat steps 9–10 such that the supernatant passes...microcentrifuge tubes. Cap the Gravitrap columns at the bottom. Add 5 mL of Pierce IgG Elution Buffer to the capped...Twist off the 10 mL Zeba Spin Desalting Column’s bottom closure and loosen cap. Place column in a 50 mL...
  13. Kit Free RNA Extraction

    Type
    Protocol
    ...new RNAse-free tube. The mixture separates into a bottom organic layer, an interphase layer, and a top, ... be a gel-like white pellet of total RNA in the bottom of the tube. Wash the RNA by resuspending the pellet..., aqueous layer. If using TRIzol®, the bottom layer will be a red-pink color. Take care to not disturb...
  14. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...X PBS, 1X pH 7.4, VWR 45000-446 250 mL sterile bottles, Corning 430281 Deionized water IgG isotype standard...deionized water. Gently remove the white sticker on the bottom of the gel. Place the gel in the electrophoresis...Use a razor blade to cut the top of the wells and bottom part of the gel where dye is visible. Section 2... protein band. Use the line tool to connect the bottom of each peak. Select the wand tool. Fill in each...
  15. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...down. Option #2 Puncture the QuickSeal tube at the bottom using an 18 ga needle. Immediately start collecting...times to mix the iodixanol that has settled at the bottom of the column. We recommend concentrating to a ...volume with formulation buffer. Use a P1000 to the bottom of the filter and pipette up/down and wash off ...
  16. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ... protocol for kit-free plasmid mini-prep at the bottom of this page. Last Update: Feb. 8, 2018 Equipment...centrifuge tube, aliquot it into several tubes/bottles. Remove the supernatant and resuspend the bacteria...appear, consisting of precipitated protein particles Bottom phase - Organic phase (protein) Pipet the aqueous...
  17. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ... Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000-446 TMB... mL of Tween-20 to into 999.5 mL 1X PBS Cap the bottle and invert several times to mix. Carefully remove... 15 minutes. Absorbance was read at 450 nm and plotted against the micrograms of antigen loaded. Last ...
  18. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...other phenotypes. For example, perform Western blotting to screen for lines with the highest or lowest...under blasticidin selection. Anti-Cas9 Western blotting was performed on whole-cell extracts from the ...
Showing: 261 - 280 of 296 results