...Containers to hold measured liquid (ex: microfuge tube, bottle, etc.) Labels for containers Reagents Liquid for...the the pipette, and the tip ejector ring at the bottom which pushes the pipette tip off of the pipette...Therefore, 1000 µL would read as 100 from top to bottom (as shown in the picture above), while 650 µL would... Therefore 100 µL would read as 100 from top to bottom (as shown in the picture above), while 95 µL would...pipettes will also have small tick marks at the bottom. For the P1000, this represents the ones. For the...measured liquid (ex: another microcentrifuge tube, a bottle etc.). If there is already other liquid in the ...this is a new container, place the tip near the bottom of and gently in contact with the container (capillary...

... growth (bottom) Loosely close the cap on the bottle (do NOT close all the way or the bottle may explode...LB, weigh out the following into a 500 mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH...!) and then loosely cover the entire top of the bottle with aluminum foil. Autoclave and allow to cool...to room temperature. Now screw on the top of the bottle and store the LB at room temperature. When ready...

...TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG ). The bottom oligo will be the reverse compliment so that they... - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5... the top oligo and 3' - G and CAGCT - 5' to the bottom oligo, making our final oligos 34 bp each: Top ... - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...oligo: 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG ...

...pH 9.0, Millipore Sigma T2819-1L 250 mL sterile bottle, VWR 430281 0.45 µm PES complete filtration unit...clamp on a clamp stand. Use scissors to cut the bottom of the Gravitrap column at the indentation in the...Gravitrap column. Collect the flow through in a 250 mL bottle. Repeat steps 9–10 such that the supernatant passes...microcentrifuge tubes. Cap the Gravitrap columns at the bottom. Add 5 mL of Pierce IgG Elution Buffer to the capped...Twist off the 10 mL Zeba Spin Desalting Column’s bottom closure and loosen cap. Place column in a 50 mL...

...new RNAse-free tube. The mixture separates into a bottom organic layer, an interphase layer, and a top, ... be a gel-like white pellet of total RNA in the bottom of the tube. Wash the RNA by resuspending the pellet..., aqueous layer. If using TRIzol®, the bottom layer will be a red-pink color. Take care to not disturb...

...X PBS, 1X pH 7.4, VWR 45000-446 250 mL sterile bottles, Corning 430281 Deionized water IgG isotype standard...deionized water. Gently remove the white sticker on the bottom of the gel. Place the gel in the electrophoresis...Use a razor blade to cut the top of the wells and bottom part of the gel where dye is visible. Section 2... protein band. Use the line tool to connect the bottom of each peak. Select the wand tool. Fill in each...

...down. Option #2 Puncture the QuickSeal tube at the bottom using an 18 ga needle. Immediately start collecting...times to mix the iodixanol that has settled at the bottom of the column. We recommend concentrating to a ...volume with formulation buffer. Use a P1000 to the bottom of the filter and pipette up/down and wash off ...

... protocol for kit-free plasmid mini-prep at the bottom of this page. Last Update: Feb. 8, 2018 Equipment...centrifuge tube, aliquot it into several tubes/bottles. Remove the supernatant and resuspend the bacteria...appear, consisting of precipitated protein particles Bottom phase - Organic phase (protein) Pipet the aqueous...

... Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000-446 TMB... mL of Tween-20 to into 999.5 mL 1X PBS Cap the bottle and invert several times to mix. Carefully remove... 15 minutes. Absorbance was read at 450 nm and plotted against the micrograms of antigen loaded. Last ...

...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...other phenotypes. For example, perform Western blotting to screen for lines with the highest or lowest...under blasticidin selection. Anti-Cas9 Western blotting was performed on whole-cell extracts from the ...

...to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the ..., load 70 µL of droplet generation oil into the bottom row of wells. Cover the cartridge with the DG8 ...disrupted insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1 mm. Touch the side...

...to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the ..., load 70 µL of droplet generation oil into the bottom row of wells. Cover the cartridge with the DG8 ...disrupted, insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1mm. Touch the side...

...microcentrifuge or falcon tube. GENTLY mix by flicking the bottom of the tube with your finger a few times. Pro-Tip...Heat shock each transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for...

...density of your DNA sample causing it settle to the bottom of the gel well, instead of diffusing in the buffer...will reach a point where the DNA will be in the bottom portion of the gel, but all of the EtBr will be...

...agar plate with appropriate antibiotic. Label the bottom of the plate with the plasmid name and the date...

...band, lay it down on the UV box and trim the top, bottom and sides with the razor blade. This is especially...

... are useful for simply collecting liquid to the bottom of a tube. You will likely encounter several different...

...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...

...stable alternative such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...

...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated...