We narrowed to 327 results for: phy

...libraries use a genetic engineering technique that physically links a protein's function (phenotype) to the...gain-of-function phenotypes Limitations Non-physiological expression Cannot capture regulatory/isoform...

...engineering and synthetic biology, compatible with PhytoBrick parts. MoBiFC - Modular Bimolecular Fluorescence...compatible with other MoClo, GoldenBraid, and PhytoBricks standards. CyanoGate Kit Bacterial Expression...

...back on itself, which helps to explain how many physically distant DNA sequences can affect transcription...

...gamma origin, 3' of MCS in pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC ADH terminator...

...be included between the ITRs is limited by the physical space available inside of the adenoviral capsid...

...convenient size (generally 1,000–20,000 base pairs) for physical isolation (purification) and manipulation. With...

...responsible for driving allergic reactions such as anaphylactic shock Monomer with a valency of 2 IgG The most...