We narrowed to 11 results for: phy

...dimerization of Phytochrome Interacting Factor 3 or 6 (PIF3 or PIF6) with PhyB 660 PhyA/FYH1 and PhyA/FHL Light-controlled...is also available 450 Phytochromes Name Description Peak excitation λ (nm) PhyB/PIF Light-controlled, ...Light-controlled reversible dimerization of PhyA with FHY1 or FHL; PhyA and FHY1 also known as REDMAP 660 BphP1...future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961 PMID: 20621963...neural activity: The biophysics of microbial rhodopsins in neuroscience. Q Rev Biophys, 57 , e1. https://...Optogenetics has been broadly applied to study the physiology of the brain and nervous system to better map...ChR1 because ChR2 has higher conductance at physiological pH and traffics well to the membrane. The optogenetic...

...and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017 PMID: 29351511...neurons expressing the LMO, depending on its biophysical properties. While LMOs provide chemogenetic access...Luminopsins integrate opto- and chemogenetics by using physical and biological light sources for opsin activation.../pnas.1510899113 PMID: 26733686 Björefeldt, A., Murphy, J., Crespo, E. L., Lambert, G. G., Prakash, M....

...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...be included between the ITRs is limited by the physical space available inside of the small AAV capsid...smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus . The Feng Zhang lab has developed plasmids...

... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA); SaCas9 3' NNGRRT or NNGRR(N) Acidaminococcus...Zhang, F. (2015). In vivo genome editing using Staphylococcus aureus Cas9. Nature , 520 (7546), 186–191. ...immunoprecipitation (enChIP) using CRISPR. Biochemical and Biophysical Research Communications . 439 (1), 132–136. https...

...libraries use a genetic engineering technique that physically links a protein's function (phenotype) to the...gain-of-function phenotypes Limitations Non-physiological expression Cannot capture regulatory/isoform...

...engineering and synthetic biology, compatible with PhytoBrick parts. MoBiFC - Modular Bimolecular Fluorescence...compatible with other MoClo, GoldenBraid, and PhytoBricks standards. CyanoGate Kit Bacterial Expression...

...back on itself, which helps to explain how many physically distant DNA sequences can affect transcription...

...gamma origin, 3' of MCS in pGP704 vector Reverse pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC ADH terminator...

...be included between the ITRs is limited by the physical space available inside of the adenoviral capsid...

...convenient size (generally 1,000–20,000 base pairs) for physical isolation (purification) and manipulation. With...

...responsible for driving allergic reactions such as anaphylactic shock Monomer with a valency of 2 IgG The most...