Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 9 results for: phy

Showing: 1 - 9 of 9 results

  1. Optogenetics Guide

    Type
    Guide
    ...light. 740–780 Phy–PIF Light-controlled Phytochrome Interacting Factor 6 (PIF6) to PhyB (Phy) interaction...utilizing FAD) domains. 441 Phytochromes BphP1–PpsR2 Bacterial phytochrome BphP1 and its natural partner...Optogenetics has been broadly applied to study the physiology of the brain and nervous system to better map...ChR1 because ChR2 has higher conductance at physiological pH and trafficks well to the membrane. Excitatory...species include: GtACR1 and GtACR2 (from the cryptophyte Guillardia theta ). Other feature enhancements...spatial and temporal control of protein activity. Phytochrome, cryptochrome, and LOV (light oxygen voltage)...domain, allowing light to activate transcription. Phytochromes and light oxygen voltage (LOV) domains function...

  2. Chemogenetics Guide

    Type
    Guide
    ...neurons expressing the LMO, depending on its biophysical properties. While LMOs provide chemogenetic access...Tools for Causal Cellular and Neuronal Biology. Physiol Rev. 98:391–418. PMID: 29351511 (Link opens in ...Luminopsins integrate opto- and chemogenetics by using physical and biological light sources for opsin activation...26733686 (Link opens in a new window) Björefeldt A, Murphy J, Crespo EL, Lambert GG, Prakash M, Ikefuama EC...

  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...be included between the ITRs is limited by the physical space available inside of the small AAV capsid...smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus . The Feng Zhang lab has developed plasmids...

  4. CRISPR Guide

    Type
    Guide
    ... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA); SaCas9 3' NNGRRT or NNGRR(N) Acidaminococcus...Zhang, F. (2015). In vivo genome editing using Staphylococcus aureus Cas9. Nature , 520 (7546), 186–191. ...immunoprecipitation (enChIP) using CRISPR. Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID...

  5. Promoters

    Type
    Guide
    ...back on itself which helps to explain how many physically distant DNA sequences can affect transcription...

  6. Sequencing Primers

    Type
    Guide
    ...origin, 3' of MCS in pGP704 vector, reverse primer pHybLex Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ...

  7. Adenovirus Guide

    Type
    Guide
    ...be included between the ITRs is limited by the physical space available inside of the adenoviral capsid...

  8. Molecular Biology Reference

    Type
    Guide
    ...convenient size (generally 1,000-20,000 basepairs) for physical isolation (purification) and manipulation. With...

  9. Antibody Guide

    Type
    Guide
    ...responsible for driving allergic reactions such as anaphylactic shock Monomer with a valency of 2 IgG The most...
Showing: 1 - 9 of 9 results