Antibody Production
Type
Collection
...protocols see the Addgene Protocols page or the Neuromab Protocols (Link opens in a new window) page. Storage...
We narrowed to 331 results for: uros
-
-
mTOR Pathway
TypeCollection...11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1; AKT1 substrate... -
Chemogenetics AAV Preps
TypeCollection...Use our chemogenetics AAV to chemically induce neuronal activity in specific cell types. See our Chemogenetics... -
Sequencing Primers
TypeGuide...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus... -
TALEN Plasmids and Kits
TypeCollection...EMM71T Golden Gate TALEN 2.0 49401 pBlue-TAL Michal Zurovec pBlue-TAL was designed for use with the Voytas ... -
The Pleiades Promoter Project
TypeCollection...., Arenillas, D. J., Babyak, N., Black, S. F., Bonaguro, R. J., Brauer, E., Candido, T. R., Castellarin... -
Science Guides
TypeGuide...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The... -
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
CRISPR Guide
TypeCollection...935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T... -
CRISPR Guide
TypeGuide...935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T...