We narrowed to 336 results for: uros

...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the...brain circuits. J Neurosci, 26 (41), 10380–10386. https://doi.org/10.1523/JNEUROSCI.3863-06.2006 PMID:... tools are particularly useful for controlling neuronal activity, but they can be deployed to interrogate...channelrhodopsin fused to mCherry is expressed in neurons (red dots). When exposed to light of the correct...flow into the cell (yellow dots), activating the neuron. Opsins Opsins are light-gated ion channels or ...and nervous system to better map and understand neuronal circuits. Optogenetic tools have also been used...

...access to projection neurons . Neuron, 92 (2), 372–382. https://doi.org/10.1016/j.neuron.2016.09.021 (Link...and cancer. Neuronal Tracing Recombinant AAV vectors have been widely used by neuroscientists to study neural... between neurons within the brain. Large-scale examples of mapping the brain through neuronal tracing ...post on using AAV for neuronal tracing . Browse AAV vectors for monosynaptic neuronal tracing available at...and alter tropism. For example, AAV2/5, targets neurons that are not efficiently transduced by AAV2, and...engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde transport...transport refers to the direction of movement within a neuron from the terminal part of the axon towards the ...

...research. This collection is part of Addgene's Neurodegeneration Research Collection , which includes other...

...requires a unique enhancer and either Ascl1 or Neurog2 activity . Development, 148(12). doi: 10.1242/dev...

...production of viruses containing transgene under Neuron-specific enolase (NSE) promoter Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus...

...protocols see the Addgene Protocols page or the Neuromab Protocols (Link opens in a new window) page. Storage...

...11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1; AKT1 substrate...

...Use our chemogenetics AAV to chemically induce neuronal activity in specific cell types. See our Chemogenetics...

...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus...

...EMM71T Golden Gate TALEN 2.0 49401 pBlue-TAL Michal Zurovec pBlue-TAL was designed for use with the Voytas ...

...., Arenillas, D. J., Babyak, N., Black, S. F., Bonaguro, R. J., Brauer, E., Candido, T. R., Castellarin...

...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

....02.001 PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T...

....02.001 PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T...